Image-Text-to-Text
Transformers
Safetensors
qwen3_vl
multimodal
scientific
protein
rna
dna
molecule
weather
medical-imaging
conversational
Instructions to use sais-org/MKB with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- Transformers
How to use sais-org/MKB with Transformers:
# Use a pipeline as a high-level helper from transformers import pipeline pipe = pipeline("image-text-to-text", model="sais-org/MKB") messages = [ { "role": "user", "content": [ {"type": "image", "url": "https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/p-blog/candy.JPG"}, {"type": "text", "text": "What animal is on the candy?"} ] }, ] pipe(text=messages)# Load model directly from transformers import AutoProcessor, AutoModelForMultimodalLM processor = AutoProcessor.from_pretrained("sais-org/MKB") model = AutoModelForMultimodalLM.from_pretrained("sais-org/MKB", device_map="auto") messages = [ { "role": "user", "content": [ {"type": "image", "url": "https://huggingface.co/datasets/huggingface/documentation-images/resolve/main/p-blog/candy.JPG"}, {"type": "text", "text": "What animal is on the candy?"} ] }, ] inputs = processor.apply_chat_template( messages, add_generation_prompt=True, tokenize=True, return_dict=True, return_tensors="pt", ).to(model.device) outputs = model.generate(**inputs, max_new_tokens=40) print(processor.decode(outputs[0][inputs["input_ids"].shape[-1]:])) - Notebooks
- Google Colab
- Kaggle
- Local Apps Settings
- vLLM
How to use sais-org/MKB with vLLM:
Install from pip and serve model
# Install vLLM from pip: pip install vllm # Start the vLLM server: vllm serve "sais-org/MKB" # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:8000/v1/chat/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "sais-org/MKB", "messages": [ { "role": "user", "content": [ { "type": "text", "text": "Describe this image in one sentence." }, { "type": "image_url", "image_url": { "url": "https://cdn.britannica.com/61/93061-050-99147DCE/Statue-of-Liberty-Island-New-York-Bay.jpg" } } ] } ] }'Use Docker
docker model run hf.co/sais-org/MKB
- SGLang
How to use sais-org/MKB with SGLang:
Install from pip and serve model
# Install SGLang from pip: pip install sglang # Start the SGLang server: python3 -m sglang.launch_server \ --model-path "sais-org/MKB" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/chat/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "sais-org/MKB", "messages": [ { "role": "user", "content": [ { "type": "text", "text": "Describe this image in one sentence." }, { "type": "image_url", "image_url": { "url": "https://cdn.britannica.com/61/93061-050-99147DCE/Statue-of-Liberty-Island-New-York-Bay.jpg" } } ] } ] }'Use Docker images
docker run --gpus all \ --shm-size 32g \ -p 30000:30000 \ -v ~/.cache/huggingface:/root/.cache/huggingface \ --env "HF_TOKEN=<secret>" \ --ipc=host \ lmsysorg/sglang:latest \ python3 -m sglang.launch_server \ --model-path "sais-org/MKB" \ --host 0.0.0.0 \ --port 30000 # Call the server using curl (OpenAI-compatible API): curl -X POST "http://localhost:30000/v1/chat/completions" \ -H "Content-Type: application/json" \ --data '{ "model": "sais-org/MKB", "messages": [ { "role": "user", "content": [ { "type": "text", "text": "Describe this image in one sentence." }, { "type": "image_url", "image_url": { "url": "https://cdn.britannica.com/61/93061-050-99147DCE/Statue-of-Liberty-Island-New-York-Bay.jpg" } } ] } ] }' - Docker Model Runner
How to use sais-org/MKB with Docker Model Runner:
docker model run hf.co/sais-org/MKB
| license: other | |
| license_name: apache-2.0-and-sam-license | |
| license_link: LICENSE | |
| library_name: transformers | |
| pipeline_tag: image-text-to-text | |
| tags: | |
| - multimodal | |
| - scientific | |
| - protein | |
| - rna | |
| - dna | |
| - molecule | |
| - weather | |
| - medical-imaging | |
| base_model: | |
| - Qwen/Qwen3-VL-8B-Instruct | |
| extra_gated_heading: You need to agree to Meta's SAM License to use the medical-image segmentation weights | |
| extra_gated_description: >- | |
| The bulk of this model is Apache-2.0. The medical-image segmentation branch | |
| embeds SAM 3 weights, which are governed by Meta's SAM License (see | |
| SAM_LICENSE.txt). By accessing these weights you agree to that license, | |
| including its acceptable-use restrictions. | |
| <div align="center"> | |
| [🤗 Model](https://huggingface.co/sais-org/MKB) • [💻 GitHub](https://github.com/Shanghai-Academy-of-AI-For-Science/MKB) • [📜 Technical Report](https://github.com/Shanghai-Academy-of-AI-For-Science/MKB/blob/main/docs/MKB.pdf) • [⚖️ License: Apache-2.0 + SAM License](https://github.com/Shanghai-Academy-of-AI-For-Science/MKB/blob/main/LICENSE) | |
| </div> | |
| # 神珍 · Monkey King Bang (MKB) | |
| **神珍 is a unified scientific multimodal foundation model** that | |
| supports scientific **understanding and generation** across Earth science, | |
| proteins, RNA, DNA, and small molecules. Native scientific encoders/decoders | |
| wrap a shared **Qwen3-VL-8B-Instruct** backbone (about **11B** parameters in | |
| total), so heterogeneous scientific data (sequences, molecular graphs, gridded | |
| physical fields, medical images) are reasoned about and generated in one | |
| representation space — natural language in and out, no per-task fine-tuning. | |
| > 📜 Read the **[technical report](https://github.com/Shanghai-Academy-of-AI-For-Science/MKB/blob/main/docs/MKB.pdf)** for architecture, training, and full benchmarks. | |
| ## Key features | |
| - **Unified understanding *and* generation** across 7 modalities through one | |
| natural-language interface. | |
| - **Seven modalities, one 8B backbone** (protein / RNA / DNA / molecule / | |
| weather / medical-image / text) via a modality router. | |
| - **Native scientific encoders/decoders** (ESM-2, RNA/DNA ConvFormers, molecular | |
| graph encoder, Swin-ViT weather tower, SAM-based image path) preserve domain | |
| structure a generic tokenizer would destroy. | |
| ## Capabilities | |
| | Modality | Understanding | Generation | | |
| |:--------------|:-------------:|:----------:| | |
| | Protein | ✅ | — | | |
| | RNA | ✅ | ✅ | | |
| | DNA | ✅ | — | | |
| | Molecule | ✅ | ✅ | | |
| | Weather | — | ✅ | | |
| | Medical image | — | ✅ | | |
| | Text | ✅ | ✅ | | |
| <sub>**Understanding** = classification / regression / scientific QA. **Generation**: RNA sequence design · Molecule text → SMILES · Weather 10-day global ERA5 0.25° forecast · Medical-image text-prompted segmentation (SAM 3-based; Meta SAM License).</sub> | |
| ## Benchmarks | |
| **神珍** (8B backbone, ~11B total) vs **Biology-Instructions** (Llama-3.1-**8B**, | |
| text-token, no scientific encoders) and **Intern-S1-Pro** (**~1T** MoE scientific | |
| model). **Bold** = best; <u>underline</u> = second-best. | |
| ### Biological sequence understanding | |
| | Task | Metric | 神珍 (~11B) | Biology-Instructions (8B) | Intern-S1-Pro (~1T) | | |
| |:-----|:------:|:----------------:|:-------------------------:|:-------------------:| | |
| | DNA · Epigenetic marks (EMP) | MCC | **71.99** | 3.64 | <u>14.02</u> | | |
| | DNA · Promoter det. 300bp (PD300) | MCC | **91.17** | 58.18 | <u>82.65</u> | | |
| | DNA · Core-promoter (CPD) | MCC | **66.35** | 44.54 | <u>54.60</u> | | |
| | DNA · Enhancer activity (EA) | PCC | 52.64 | <u>53.28</u> | **55.16** | | |
| | RNA · ncRNA function | Acc | **91.46** | <u>63.09</u> | 34.50 | | |
| | RNA · Modification | AUC | **96.03** | <u>59.06</u> | 57.77 | | |
| | RNA · APA isoform | R² | <u>79.87</u> | 59.01 | **82.95** | | |
| | RNA · CRISPR on-target | Spearman ρ | **28.76** | -0.02 | <u>15.69</u> | | |
| | Protein · Stability | Spearman ρ | **70.63** | 60.25 | <u>60.82</u> | | |
| | Protein · Fluorescence | Spearman ρ | <u>70.12</u> | 2.57 | **78.14** | | |
| | Protein · Enzyme Commission | Fmax | <u>68.65</u> | 19.79 | **72.70** | | |
| | Protein · Solubility | Acc | <u>67.26</u> | 63.02 | **67.60** | | |
| | Cross-modal · RPI (RNA–protein) | MCC | **76.49** | <u>74.26</u> | 58.51 | | |
| | Cross-modal · AAN (antibody–antigen) | MCC | <u>42.96</u> | 1.06 | **44.76** | | |
| | Cross-modal · EPI (enhancer–promoter) | MCC | <u>-0.03</u> | **3.37** | -1.30 | | |
| <sub>Aggregate over 20 biological-understanding benchmarks: 神珍 matches or beats the ~1T Intern-S1-Pro on 10/20 and the same-scale 8B text-token baseline on 16/20.</sub> | |
| ### Molecule understanding (SMolInstruct) | |
| | Task | Metric | 神珍 (~11B) | LlaSMol | | |
| |:-----|:------:|:----------------:|:-------:| | |
| | BBBP | Acc | **96.95** | 74.60 | | |
| | HIV | Acc | **97.00** | 96.70 | | |
| | SIDER | Acc | **71.00** | 70.70 | | |
| | ClinTox | Acc | 92.36 | **93.10** | | |
| | ESOL | RMSE ↓ | **0.550** | 1.150 | | |
| | Lipophilicity | RMSE ↓ | **0.628** | 1.010 | | |
| ### Earth-science forecasting — vs ECMWF HRES (day-10, global ERA5 0.25°) | |
| | Variable | Metric | 神珍 (~11B) | ECMWF HRES (NWP) | | |
| |:---------|:------:|:----------------:|:----------------:| | |
| | Z500 | RMSE ↓ | **≈740** | ≈810 | | |
| | T2M | RMSE ↓ (K) | **≈2.65** | ≈2.90 | | |
| | MSL | RMSE ↓ (Pa) | **≈680** | ≈745 | | |
| <sub>神珍 tracks or beats the operational physics-based HRES system, with the advantage growing at longer lead times.</sub> | |
| ### Medical-image segmentation | |
| Mean Dice (%) on the BiomedParse test splits, 102,855 image–prompt pairs across | |
| nine imaging modalities, versus six modality-native segmentation specialists. | |
| | Modality | # Samples | 神珍 | BiomedParse | MedSAM | SAM | SAM3 | DINO+MedSAM | DINO+SAM | | |
| |:---------|----------:|:-----------:|:-----------:|:------:|:---:|:----:|:-----------:|:--------:| | |
| | **All** | 102,855 | **91.20** | <u>90.73</u> | 83.55 | 71.29 | 35.40 | 15.37 | 15.10 | | |
| | CT | 45,306 | **93.36** | <u>92.25</u> | 83.87 | 74.10 | 28.93 | 9.59 | 10.34 | | |
| | MRI | 30,990 | **85.29** | <u>85.25</u> | 75.90 | 68.34 | 53.64 | 13.28 | 12.39 | | |
| | OCT | 283 | <u>85.31</u> | **86.63** | 56.26 | 55.99 | 8.69 | 6.68 | 6.98 | | |
| | X-ray | 13,840 | <u>98.02</u> | **98.28** | 97.75 | 81.35 | 39.96 | 37.22 | 30.63 | | |
| | Dermoscopy | 65 | **98.08** | 97.11 | <u>97.35</u> | 88.23 | 51.47 | 81.28 | 78.29 | | |
| | Endoscopy | 410 | **97.39** | 96.77 | <u>97.05</u> | 92.88 | 38.82 | 25.01 | 24.54 | | |
| | Fundus | 800 | <u>91.33</u> | **91.50** | 88.06 | 57.16 | 18.58 | 3.19 | 2.73 | | |
| | Pathology | 977 | **87.29** | <u>81.57</u> | 43.44 | 42.06 | 26.08 | 25.38 | 24.69 | | |
| | Ultrasound | 10,184 | <u>90.54</u> | **91.03** | 89.76 | 57.47 | 5.23 | 17.12 | 22.91 | | |
| <sub>Best overall Dice (All), and best on CT, MRI, pathology, dermoscopy, and endoscopy; on X-ray, Fundus, and Ultrasound the gap to BiomedParse is ≤ 0.5 Dice, and on the smallest split (OCT) it is 1.3.</sub> | |
| ## Usage | |
| Runs via the accompanying code repository (custom multimodal architecture). | |
| ```bash | |
| git clone https://github.com/Shanghai-Academy-of-AI-For-Science/MKB && cd MKB | |
| pip install -r requirements.txt # Python 3.10; transformers==5.0.0 | |
| hf download sais-org/MKB --local-dir ./model | |
| export PYTHONPATH=$PWD/code | |
| python code/inference.py --model_path model --greedy --max_new_tokens 64 \ | |
| --rna "GGATGCGATCATGTCTGCACTAACACACCGGATCCCATCAGAACTCCGAAGTTAAGCGTGCTTGGGCGGGAGTAGTACTAGGATGGGCGACCCCTTAGGAAGTACTCGTGTTGCATCCC" \ | |
| --system "You are a non-coding RNA family classifier. Output only the family name, no other text." \ | |
| --prompt $'<rna>\nWhich family does this non-coding RNA sequence belong to?' | |
| ``` | |
| All weights are contained in `model.safetensors`: the scientific | |
| encoders/decoders (ESM-2, the Suiren molecular graph encoder, the RNA/DNA | |
| ConvFormers, the Swin-ViT weather tower) and the fine-tuned SAM 3 branch used | |
| for medical-image segmentation. | |
| Each task has a specific `--system` prompt that fixes the output format; see | |
| `run_examples.sh` in the repository for per-task examples, weather, and segmentation. | |
| ## License | |
| **Composite license.** 神珍's own components — the code, and all weights | |
| except the SAM 3 branch — are **Apache-2.0**, built on Qwen3-VL (Apache-2.0) and | |
| including merged ESM-2 (MIT) and Polaris/Suiren-derived encoders. | |
| The **medical-image segmentation branch embeds SAM 3 weights**, which are | |
| governed by **Meta's SAM License** (`SAM_LICENSE.txt`, shipped alongside these | |
| weights). SAM 3 use is subject to that license, including its acceptable-use | |
| restrictions (no military / weapons / illegal uses; Trade-Control compliance). | |
| See `THIRD_PARTY_LICENSES.md` / `NOTICE` for the full third-party breakdown. | |
| ## Citation | |
| ```bibtex | |
| @misc{mkb2026, | |
| title = {MonkeyKing Bang: A Unified Scientific Multimodal Foundation Model}, | |
| author = {Hesen Chen and Xinyu Su and Xiaomeng Yang and Yuetan Lin and Zixiong Yang and Zhiyu Tan and Hao Li}, | |
| year = {2026}, | |
| note = {https://huggingface.co/sais-org/MKB} | |
| } | |
| ``` | |