SPOT-RNA

Pre-trained model for RNA secondary structure prediction using two-dimensional deep neural networks and transfer learning.

Disclaimer

This is an UNOFFICIAL implementation of the RNA secondary structure prediction using an ensemble of two-dimensional deep neural networks and transfer learning by Jaswinder Singh, et al.

The OFFICIAL repository of SPOT-RNA is at jaswindersingh2/SPOT-RNA.

The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation.

The team releasing SPOT-RNA did not write this model card for this model so this model card has been written by the MultiMolecule team.

Model Details

SPOT-RNA is a 2D convolutional neural network for predicting RNA secondary structure (base-pair contact maps) from single RNA sequences. It predicts both canonical (Watson-Crick and wobble) and non-canonical base pairs, including pseudoknots and other tertiary interactions.

The model uses:

  • pairwise representation: outer concatenation of canonical nucleotide features into an L x L x 8 feature matrix.
  • convolutional blocks: 2D residual convolution blocks with LayerNorm, dropout, and checkpoint-matched ReLU/ELU activations.
  • architecture paths: checkpoint-matched 2D-BLSTM or dilated-convolution paths where used by the released predictor.
  • training strategy: transfer learning from bpRNA to high-resolution PDB RNA structures.

MultiMolecule provides SPOT-RNA as a single checkpoint, multimolecule/spotrna.

Model Specification

Num Parameters (M) FLOPs (G) MACs (G)
17.46 8642.10 4302.16

Links

Usage

The model file depends on the multimolecule library. You can install it using pip:

pip install multimolecule

Direct Use

RNA Secondary Structure Pipeline

You can use SPOT-RNA directly with the MultiMolecule secondary-structure pipeline:

import multimolecule  # you must import multimolecule to register models
from transformers import pipeline

predictor = pipeline("rna-secondary-structure", model="multimolecule/spotrna")
output = predictor("GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCUCA")

PyTorch Inference

Here is how to use this model to predict RNA secondary structure in PyTorch:

import torch
from multimolecule import RnaTokenizer, SpotRnaModel

tokenizer = RnaTokenizer.from_pretrained("multimolecule/spotrna")
model = SpotRnaModel.from_pretrained("multimolecule/spotrna")

sequence = "GGGCUAUUAGCUCAGUUGGUUAGAGCGCACCCCUGAUAAGGGUGAGGUCGCUGAUUCGAAUUCAGCAUAGCUCA"
input = tokenizer(sequence, return_tensors="pt")

output = model(**input)
contact_map = output.contact_map  # (1, L, L) base-pair probability matrix

Training Details

SPOT-RNA was trained using a two-stage transfer learning approach on RNA secondary structure prediction.

Training Data

  • initial training source: bpRNA-1m (Version 1.0) with 102,348 annotated RNAs.
  • initial training filtering: CD-HIT-EST at 80% sequence identity, removal of RNAs with PDB structures, and maximum sequence length of 500 nucleotides.
  • initial training corpus: 13,419 RNAs after preprocessing.
  • initial training split: TR0 = 10,814, VL0 = 1,300, TS0 = 1,305.
  • transfer-learning source: high-resolution PDB RNAs downloaded on March 2, 2019.
  • transfer-learning filtering: resolution better than 3.5 A and CD-HIT-EST at 80% sequence identity.
  • transfer-learning corpus: 226 nonredundant RNAs after preprocessing.
  • transfer-learning split before homology filtering: TR1 = 120, VL1 = 30, TS1 = 76.
  • additional TS1 filtering: CD-HIT-EST against the training data at 80% identity, followed by BLAST-N against TR0 and TR1 with e-value cutoff 10.
  • final TS1 benchmark: 67 RNAs.
  • additional evaluation set: TS2 = 39 NMR-solved RNAs selected from 641 candidates after CD-HIT-EST filtering at 80% identity and BLAST-N filtering against TR0, TR1, and TS1.
  • use of TS2: post-training evaluation only.

Training Procedure

Preprocessing

  • input representation: one-hot L x 4 matrix following the MultiMolecule tokenizer order.
  • missing-value handling: invalid or missing residues encoded as -1 in the original TensorFlow implementation before one-hot conversion.
  • pairwise features: outer concatenation from L x 4 to L x L x 8.
  • input normalization: standardization to zero mean and unit variance using training-set statistics.
  • structure labels: extracted from PDB coordinates with DSSR.
  • reference NMR model: model 1.
  • pseudoknot and motif definitions: bpRNA definitions from the paper.
  • unknown-token handling: N tokens are excluded from the canonical four-base features before pairwise feature construction.

Pre-training

The paper states that training was run on Nvidia GTX TITAN X GPUs.

  • training split: TR0.
  • validation split: VL0.
  • optimizer: Adam.
  • regularization: 25% dropout before convolution layers and 50% dropout in hidden fully connected layers.
  • hyperparameter search over N_A: 16 to 32 residual blocks.
  • hyperparameter search over D_RES: 32 to 72 convolution channels.
  • hyperparameter search over D_BL: 128 to 256 2D-BLSTM hidden units per direction.
  • hyperparameter search over N_B: 0 to 4 fully connected blocks.
  • hyperparameter search over D_FC: 256 to 512 fully connected hidden units.
  • model selection: validation-performance model selection described in the paper.

Transfer Learning

The pretrained TR0 models were retrained on TR1 with the same architecture and optimization settings.

  • initialization: start from the TR0-trained models.
  • training split: TR1.
  • validation split: VL1.
  • frozen layers: none; all weights were updated.
  • architecture and optimization settings: same as the TS0-trained models.
  • model selection: validation-performance model selection described in the paper.
  • decision rule: a single probability threshold chosen to optimize validation performance.

Citation

@article{singh2019rna,
  title     = "{RNA} secondary structure prediction using an ensemble of two-dimensional deep neural networks and transfer learning",
  author    = "Singh, Jaswinder and Hanson, Jack and Paliwal, Kuldip and Zhou, Yaoqi",
  journal   = "Nature Communications",
  doi       = "10.1038/s41467-019-13395-9",
  publisher = "Springer Science and Business Media LLC",
  url       = "https://doi.org/10.1038/s41467-019-13395-9",
  volume    =  10,
  number    =  1,
  pages     = "5407",
  month     =  nov,
  year      =  2019,
  copyright = "https://creativecommons.org/licenses/by/4.0",
  language  = "en"
}

The artifacts distributed in this repository are part of the MultiMolecule project. If MultiMolecule supports your research, please cite the MultiMolecule project as follows:

@software{chen_2024_12638419,
  author    = {Chen, Zhiyuan and Zhu, Sophia Y.},
  title     = {MultiMolecule},
  doi       = {10.5281/zenodo.12638419},
  publisher = {Zenodo},
  url       = {https://doi.org/10.5281/zenodo.12638419},
  year      = 2024,
  month     = may,
  day       = 4
}

Contact

Please use GitHub issues of MultiMolecule for any questions or comments on the model card.

Please contact the authors of the SPOT-RNA paper for questions or comments on the paper/model.

License

This model implementation is licensed under the GNU Affero General Public License.

For additional terms and clarifications, please refer to our License FAQ.

SPDX-License-Identifier: AGPL-3.0-or-later
Downloads last month
54
Safetensors
Model size
17.5M params
Tensor type
F32
·
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support

Dataset used to train multimolecule/spotrna

Space using multimolecule/spotrna 1