You need to agree to share your contact information to access this model

This repository is publicly accessible, but you have to accept the conditions to access its files and content.

Log in or Sign Up to review the conditions and access this model content.

Botanic1-M SAEs โ€” k=64, codebook 8192

BatchTopK sparse autoencoders over the residual stream of living-models/Botanic1-M, one per probed block. Each decomposes a base's 1024-d hidden state into a sparse combination of 8192 learned features.

Layer Depth Held-out EV Threshold rms_scale Dead features
13 0.25 0.830 1.0119261741638184 1.6462319514670176 0.66%
26 0.50 0.780 0.966841995716095 0.5425183788529638 0
35 0.67 0.749 0.8141039609909058 0.2214300936095105 0
47 0.90 0.727 0.881266176700592 0.13001471952870194 0

Shared across layers: d_in 1024 โ†’ d_sae 8192 (expansion 8), BatchTopK k=64, site hidden_states[layer] โ€” the output of that BiMamba2 block. Full trainer metrics (L0 distribution, activation-frequency deciles, held-out MSE) are in metrics.json.

Usage

import torch
from transformers import AutoModel, AutoTokenizer

model = AutoModel.from_pretrained("living-models/Botanic1-M", trust_remote_code=True).eval()
tokenizer = AutoTokenizer.from_pretrained("living-models/Botanic1-M", trust_remote_code=True)
sae = AutoModel.from_pretrained(
    "living-models/Botanic1-M-sae-k64-codebook8192", trust_remote_code=True
).eval()
print(sae.available_layers)   # [13, 26, 35, 47]

# PHYB (AT2G18790) in Arabidopsis thaliana: 500 bp around the ATG start codon.
# 5'UTR is bases 0-249; the CDS starts at base 250.
sequence = (
    "TTTTTTTTTGTTATCTCTCTCTATCTGAGAGGCACACATTTTGCTTCGTCTTCTTCAATTTATTTTATTGGTTTCTC"
    "CACTTATCTCCGATCTCAATTCTCCCCATTTTCTTCTTCCTCAAGTTCAAAATTCTTGAGAATTTAGCTCTACCAGA"
    "ATTCGTCTCCGATAACTAGTGGATGATGATTCACCCTAAATCCTTCCTTGTCTCAAGGTAATTCTGAGAAATTTCTC"
    "AAATTCAAAATCAAACGGCATGGTTTCCGGAGTCGGGGGTAGTGGCGGTGGCCGTGGCGGTGGCCGTGGCGGAGAA"
    "GAAGAACCGTCGTCAAGTCACACTCCTAATAACCGAAGAGGAGGAGAACAAGCTCAATCGTCGGGAACGAAATCTC"
    "TCAGACCAAGAAGCAACACTGAATCAATGAGCAAAGCAATTCAACAGTACACCGTCGACGCAAGACTCCACGCCGT"
    "TTTCGAACAATCCGGCGAATCAGGGAAATCATTCGACTACT"
)

z = sae.encode_sequences([sequence], model, tokenizer, layer=35)  # (1, n_bases, 8192)
print(z.shape, "active per base:", (z[0] > 0).sum(-1).float().mean().item())

encode_sequences tokenizes, runs the backbone, takes hidden_states[layer], drops the <cls> column and encodes โ€” so z[b, i] is the feature vector of base sequence[i].

Which features fire, and where

peak, base = z[0].max(dim=0)                      # each feature's strongest base
top = peak.topk(10)
for value, feature in zip(top.values, top.indices):
    print(f"feature {feature.item():5d}  peak {value.item():7.3f}  at base {base[feature].item()}")
# feature  1589  peak  22.790  at base 250   <- the A of the ATG start codon

# the strongest features at the A of the ATG start codon
atg = z[0, 250].topk(5)
print(list(zip(atg.indices.tolist(), atg.values.tolist())))

Comparing depths

for layer in sae.available_layers:
    z = sae.encode_sequences([sequence], model, tokenizer, layer=layer)
    peak, base = z[0].max(dim=0)
    strongest = int(peak.argmax())
    print(f"layer {layer:>2}  L0 {(z[0] > 0).sum(-1).float().mean():6.2f}  "
          f"top feature {strongest:5d} @ base {base[strongest].item()}")

Encoding activations you already have

with torch.no_grad():
    out = model(input_ids=tokenizer([sequence], return_tensors="pt")["input_ids"],
                output_hidden_states=True, return_logits=False)
    hidden = out.hidden_states[35][:, sae.config.cls_offset:]   # (1, n_bases, 1024)

    z = sae.encode(hidden, layer=35)        # applies rms_scale + the pinned threshold
    recon = sae.decode(z, layer=35) / sae.config.layer_config["35"]["rms_scale"]

print("fraction of variance kept:", (1 - (recon - hidden).var() / hidden.var()).item())
# 0.8791

Reading a feature's direction

dictionary = sae.dictionary(35)
direction = dictionary.W_dec[2810]     # (1024,) โ€” feature 2810 in residual space
cosine = torch.nn.functional.normalize(dictionary.W_dec, dim=-1) @ \
         torch.nn.functional.normalize(direction, dim=-1)
print("nearest features:", cosine.topk(6).indices.tolist()[1:])

Notes

Four things change the numbers if you bypass encode_sequences:

  • rms_scale is per layer, and the spread is wide โ€” 1.65 at layer 13 down to 0.13 at layer 47. Pairing one layer's activations with another layer's scale is a silent order-of-magnitude error, so encode takes layer and reads the scale itself rather than accepting one.
  • <cls> shifts every coordinate. The Botanic1 tokenizer prepends <cls> (tokenizer("ACGT")["input_ids"] == [3, 4, 6, 7, 5]), so base i is token i + 1. Slice it off before encoding.
  • hidden_states[i] is the output of block i. Botanic1's list has exactly 52 entries and no embedding entry, so there is no off-by-one to correct here โ€” hidden_states[35] is the right tensor for the layer-35 dictionary.
  • Batch equal lengths. Botanic1's SSM scans do not mask pad tokens, so a padded batch changes the activations of the real bases in shorter rows.

These dictionaries were fit on activations captured in bfloat16, while the released Botanic1-M runs in float32. Feature activations from this repository therefore agree with the published feature statistics to about 0.4% median relative error and 98-99% support overlap, not exactly, at every layer.

encode applies the single threshold the trainer converged on rather than a per-batch top-k, so one position's activations never depend on which other positions travelled with it.

Citation

Technical report: BOTANIC-1: a series of long-context plant genomic foundation models in the agentic era (bioRxiv, 2026).

@article{Barozet2026.09.04.749355,
    author = {Barozet, Am{\'e}lie and Cabeli, Vincent and Ogier du Terrail, Jean
              and Rukhovich, Alexey and Janssoone, Thomas and Klajer, Gary
              and Sheikhitarghi, Zeinab and Andrews, Gregory and Veran, Cyril
              and Strouk, L{\'e}onard},
    title = {BOTANIC-1: a series of long-context plant genomic foundation
             models in the agentic era},
    journal = {bioRxiv},
    year = {2026},
    elocation-id = {2026.09.04.749355},
    doi = {10.64898/2026.09.04.749355},
    publisher = {Cold Spring Harbor Laboratory},
    URL = {https://www.biorxiv.org/content/early/2026/09/09/2026.09.04.749355},
    eprint = {https://www.biorxiv.org/content/early/2026/09/09/2026.09.04.749355.full.pdf},
}

Research use only

See LICENSE. Not for production, clinical or diagnostic use.

Downloads last month
5
Safetensors
Model size
67.1M params
Tensor type
F32
ยท
Inference Providers NEW
This model isn't deployed by any Inference Provider. ๐Ÿ™‹ Ask for provider support

Model tree for living-models/Botanic1-M-sae-k64-codebook8192

Finetuned
(1)
this model

Space using living-models/Botanic1-M-sae-k64-codebook8192 1

Collection including living-models/Botanic1-M-sae-k64-codebook8192