Dataset Preview
The full dataset viewer is not available (click to read why). Only showing a preview of the rows.
The dataset generation failed
Error code: DatasetGenerationError
Exception: CastError
Message: Couldn't cast
builder_version: string
built_at: timestamp[s]
dataset: string
license: string
locus_count: int64
source: string
source_sha256: string
source_url: string
to
{'id': Value('string'), 'disease_id': Value('string'), 'gene': Value('string'), 'evidence': List(Value('string')), 'chrom': Value('string'), 'start_hg38': Value('int64'), 'stop_hg38': Value('int64'), 'start_hg19': Value('int64'), 'stop_hg19': Value('int64'), 'start_t2t': Value('int64'), 'stop_t2t': Value('int64'), 'disease': Value('string'), 'inheritance': List(Value('string')), 'association_type': List(Value('string')), 'disease_description': Value('string'), 'hpo_terms': List(Value('string')), 'prevalence': Value('string'), 'prevalence_details': Value('string'), 'age_onset': Value('string'), 'age_onset_min': Value('float64'), 'age_onset_max': Value('float64'), 'typ_age_onset_min': Value('float64'), 'typ_age_onset_max': Value('float64'), 'details': Value('string'), 'detection': Value('string'), 'mechanism': Value('string'), 'mechanism_detail': Value('string'), 'year': Value('string'), 'location_in_gene': Value('string'), 'gene_strand': Value('string'), 'reference_motif_reference_orientation': List(Value('string')), 'pathogenic_motif_reference_orientation': List(Value('string')), 'benign_motif_reference_orientation': List(Value('string')), 'unknown_motif_reference_orientation': List(Value('string')), 'interruption_reference_orientation': List(Value('string')), 'pathogenic_motif_gene_orientation': List(Value('string')), 'benign_motif_gene_orientation': List(Value('string')), 'unknown_motif_gene_orientation': List(Value('string')), 'interruption_gene_orientation': List(Value('string')), 'locus_structure': List({'motif': Value('string'), 'count': Value('int64'), 'type': Value('string')}), 'benign_min': Value('int64'), 'benign_max': Value('int64'), 'intermediate_min': Value('int64'), 'intermediate_max': Value('int64'), 'pathogenic_min': Value('int64'), 'pathogenic_max': Value('int64'), 'motif_len': Value('int64'), 'ref_copies': Value('float64'), 'novel': Value('string'), 'gard': List(Value('string')), 'genereviews': List(Value('string')), 'malacard': List(Value('string')), 'medgen': List(Value('string')), 'mondo': List(Value('string')), 'omim': List(Value('string')), 'orphanet': List(Value('string')), 'gnomad': List(Value('string')), 'stripy': List(Value('string')), 'tr_atlas': List(Value('string')), 'webstr_hg38': List(Value('string')), 'webstr_hg19': List(Value('string')), 'locus_tags': List(Value('string')), 'disease_tags': List(Value('string')), 'references': List(Value('string')), 'additional_literature': List(Value('string'))}
because column names don't match
Traceback: Traceback (most recent call last):
File "/usr/local/lib/python3.14/site-packages/datasets/builder.py", line 1869, in _prepare_split_single
num_examples, num_bytes = writer.finalize()
~~~~~~~~~~~~~~~^^
File "/usr/local/lib/python3.14/site-packages/datasets/arrow_writer.py", line 781, in finalize
self.write_rows_on_file()
~~~~~~~~~~~~~~~~~~~~~~~^^
File "/usr/local/lib/python3.14/site-packages/datasets/arrow_writer.py", line 663, in write_rows_on_file
self._write_table(table)
~~~~~~~~~~~~~~~~~^^^^^^^
File "/usr/local/lib/python3.14/site-packages/datasets/arrow_writer.py", line 773, in _write_table
pa_table = table_cast(pa_table, self._schema)
File "/usr/local/lib/python3.14/site-packages/datasets/table.py", line 2378, in table_cast
return cast_table_to_schema(table, schema)
File "/usr/local/lib/python3.14/site-packages/datasets/table.py", line 2306, in cast_table_to_schema
raise CastError(
...<3 lines>...
)
datasets.table.CastError: Couldn't cast
builder_version: string
built_at: timestamp[s]
dataset: string
license: string
locus_count: int64
source: string
source_sha256: string
source_url: string
to
{'id': Value('string'), 'disease_id': Value('string'), 'gene': Value('string'), 'evidence': List(Value('string')), 'chrom': Value('string'), 'start_hg38': Value('int64'), 'stop_hg38': Value('int64'), 'start_hg19': Value('int64'), 'stop_hg19': Value('int64'), 'start_t2t': Value('int64'), 'stop_t2t': Value('int64'), 'disease': Value('string'), 'inheritance': List(Value('string')), 'association_type': List(Value('string')), 'disease_description': Value('string'), 'hpo_terms': List(Value('string')), 'prevalence': Value('string'), 'prevalence_details': Value('string'), 'age_onset': Value('string'), 'age_onset_min': Value('float64'), 'age_onset_max': Value('float64'), 'typ_age_onset_min': Value('float64'), 'typ_age_onset_max': Value('float64'), 'details': Value('string'), 'detection': Value('string'), 'mechanism': Value('string'), 'mechanism_detail': Value('string'), 'year': Value('string'), 'location_in_gene': Value('string'), 'gene_strand': Value('string'), 'reference_motif_reference_orientation': List(Value('string')), 'pathogenic_motif_reference_orientation': List(Value('string')), 'benign_motif_reference_orientation': List(Value('string')), 'unknown_motif_reference_orientation': List(Value('string')), 'interruption_reference_orientation': List(Value('string')), 'pathogenic_motif_gene_orientation': List(Value('string')), 'benign_motif_gene_orientation': List(Value('string')), 'unknown_motif_gene_orientation': List(Value('string')), 'interruption_gene_orientation': List(Value('string')), 'locus_structure': List({'motif': Value('string'), 'count': Value('int64'), 'type': Value('string')}), 'benign_min': Value('int64'), 'benign_max': Value('int64'), 'intermediate_min': Value('int64'), 'intermediate_max': Value('int64'), 'pathogenic_min': Value('int64'), 'pathogenic_max': Value('int64'), 'motif_len': Value('int64'), 'ref_copies': Value('float64'), 'novel': Value('string'), 'gard': List(Value('string')), 'genereviews': List(Value('string')), 'malacard': List(Value('string')), 'medgen': List(Value('string')), 'mondo': List(Value('string')), 'omim': List(Value('string')), 'orphanet': List(Value('string')), 'gnomad': List(Value('string')), 'stripy': List(Value('string')), 'tr_atlas': List(Value('string')), 'webstr_hg38': List(Value('string')), 'webstr_hg19': List(Value('string')), 'locus_tags': List(Value('string')), 'disease_tags': List(Value('string')), 'references': List(Value('string')), 'additional_literature': List(Value('string'))}
because column names don't match
The above exception was the direct cause of the following exception:
Traceback (most recent call last):
File "/src/services/worker/src/worker/job_runners/config/parquet_and_info.py", line 1369, in compute_config_parquet_and_info_response
parquet_operations, partial, estimated_dataset_info = stream_convert_to_parquet(
~~~~~~~~~~~~~~~~~~~~~~~~~^
builder, max_dataset_size_bytes=max_dataset_size_bytes
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
)
^
File "/src/services/worker/src/worker/job_runners/config/parquet_and_info.py", line 948, in stream_convert_to_parquet
builder._prepare_split(split_generator=splits_generators[split], file_format="parquet")
~~~~~~~~~~~~~~~~~~~~~~^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
File "/usr/local/lib/python3.14/site-packages/datasets/builder.py", line 1694, in _prepare_split
for job_id, done, content in self._prepare_split_single(
~~~~~~~~~~~~~~~~~~~~~~~~~~^
gen_kwargs=gen_kwargs, job_id=job_id, **_prepare_split_args
^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^^
):
^
File "/usr/local/lib/python3.14/site-packages/datasets/builder.py", line 1880, in _prepare_split_single
raise DatasetGenerationError("An error occurred while generating the dataset") from e
datasets.exceptions.DatasetGenerationError: An error occurred while generating the datasetNeed help to make the dataset viewer work? Make sure to review how to configure the dataset viewer, and open a discussion for direct support.
id string | disease_id string | gene string | evidence list | chrom string | start_hg38 int64 | stop_hg38 int64 | start_hg19 int64 | stop_hg19 int64 | start_t2t int64 | stop_t2t int64 | disease string | inheritance list | association_type list | disease_description string | hpo_terms list | prevalence string | prevalence_details string | age_onset string | age_onset_min float64 | age_onset_max float64 | typ_age_onset_min float64 | typ_age_onset_max float64 | details string | detection string | mechanism string | mechanism_detail string | year string | location_in_gene string | gene_strand string | reference_motif_reference_orientation list | pathogenic_motif_reference_orientation list | benign_motif_reference_orientation list | unknown_motif_reference_orientation list | interruption_reference_orientation list | pathogenic_motif_gene_orientation list | benign_motif_gene_orientation list | unknown_motif_gene_orientation list | interruption_gene_orientation list | locus_structure list | benign_min int64 | benign_max int64 | intermediate_min int64 | intermediate_max int64 | pathogenic_min int64 | pathogenic_max int64 | motif_len int64 | ref_copies float64 | novel string | gard list | genereviews list | malacard list | medgen list | mondo list | omim list | orphanet list | gnomad list | stripy list | tr_atlas list | webstr_hg38 list | webstr_hg19 list | locus_tags list | disease_tags list | references list | additional_literature list |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
OPDM5_ABCD3 | OPDM5 | ABCD3 | [
"Moderate"
] | chr1 | 94,418,421 | 94,418,444 | 94,883,977 | 94,884,000 | 94,266,544 | 94,266,567 | Oculopharyngodistal myopathy type 5 | [
"AD"
] | [
"Mendelian"
] | Oculopharyngodistal myopathy (OPDM) is a rare, adult-onset hereditary muscle disease. People with OPDM present with progressive eye and throat (pharyngeal) problems and involvement of the muscles of the lower legs and arms. Symptoms may include eyelid drooping (ptosis), swallowing difficulty, hoarse and nasal voice, le... | [
"HP:0000183 Tongue muscle weakness",
"HP:0000218 High palate",
"HP:0000301 Abnormality of facial musculature",
"HP:0000408 Progressive sensorineural hearing impairment",
"HP:0000590 Progressive external ophthalmoplegia",
"HP:0000597 Ophthalmoparesis",
"HP:0001284 Areflexia",
"HP:0001288 Gait disturban... | null | Found in individuals of European, Japanese, and Chinese ancestry [@pmid:38876750; @pmid:34047774]. | Typical: 24-30; Range: 10-50 [@pmid:39068203]. Age of onset data is limited to 8 families. | 10 | 50 | 24 | 30 | Characterized in eight unrelated families which were used to establish benign (3-44) and pathogenic (118-694) ranges [@pmid:39068203]. | RP-PCR has been used for detection [@pmid:39068203]. Short-read sequencing has significantly underestimated repeat count, while long-read sequencing has accurately resolved size [@pmid:39068203]. | null | Potentially over-expression of transcripts [@pmid:39068203]. | 2023 [@pmid:39068203] | 5' UTR | + | [
"CCG"
] | [
"CCG"
] | [] | [] | [] | [
"CCG"
] | [] | [] | [] | [] | 3 | 44 | null | null | 118 | 694 | 3 | 7.7 | ref | [
"12592"
] | [] | [] | [
"320250"
] | [
"0025193"
] | [] | [
"98897"
] | [
"ABCD3"
] | [] | [
"TR5671"
] | [
"1164141",
"6329150"
] | [
"STR_58687"
] | [] | [
"oculopharyngodistal_myopathy"
] | [
"pmid:39068203",
"pmid:38876750",
"pmid:34047774",
"mondo:0025193"
] | [
"pmid:41959811",
"pmid:41792844",
"pmid:40645757"
] |
FRAXE_AFF2 | FRAXE | AFF2 | [
"Definitive"
] | chrX | 148,500,604 | 148,500,753 | 147,582,124 | 147,582,273 | 146,765,190 | 146,765,342 | Intellectual developmental disorder, Fragile X intellectual disability | [
"XR"
] | [
"Mendelian"
] | A nonsyndromic X-linked intellectual development disorder characterized by mild intellectual deficit. FRAXE is the most common form of non-syndromic X-linked disability [@mondo:0010659]. | [
"HP:0000252 Microcephaly",
"HP:0000256 Macrocephaly",
"HP:0000286 Epicanthus",
"HP:0000426 Prominent nasal bridge",
"HP:0000713 Agitation",
"HP:0000718 Aggressive behavior",
"HP:0000722 Compulsive behaviors",
"HP:0000729 Autistic behavior",
"HP:0000750 Delayed speech and language development",
"HP... | 2/50000 | 1-4/100,000 males [@url:medlineplus.gov/genetics/condition/fragile-xe-syndrome]; 1/50-100,000 males, more than 50 families [@pmid:11246464]. Found in populations around the globe, including in the UK, US, Canada, Taiwan, Germany, Greece, Cyprus, Spain, and Finland [@pmid:11246464]. | Typical: 2-10 [@pmid:11246464]. Range: 1-10; developmental delays without physical features can make onset difficult to detect until schooling [@omim:309548]. | 1 | 10 | 2 | 10 | Allele ranges (benign: 4-39; pathogenic: >200) inferred from The Human Gene Mutation Database [@genereviews:NBK535148]. Intermediate alleles correspond to a premutation [@pmid:23914978]. Non-canonical motifs include: CGG/CCT/GTG/CAG/CTG3 [@pmid:35245110; @pmid:34111553]. | RP-PCR has been used to detect expansions and size alleles to ~80 repeats, while Southern blotting has sized full expansions and detected methylation using NotI, a methylation-sensitive restriction enzyme [@pmid:34282157]. | LoF | Loss of function via transcriptional silencing [@pmid:16205714; @pmid:36169768]. | 1993 [@pmid:8334699] | 5' UTR | + | [
"CCG"
] | [
"CCG"
] | [] | [] | [] | [
"CCG"
] | [] | [] | [] | [] | 4 | 39 | 40 | 200 | 201 | 2,000 | 3 | 50.3 | ref | [
"2378"
] | [
"NBK535148"
] | [
"INT399"
] | [
"155512"
] | [
"0010659"
] | [
"309548"
] | [
"100973"
] | [
"AFF2"
] | [
"AFF2"
] | [
"TR173976"
] | [] | [] | [
"somatic_instability",
"anticipation",
"maternal_expansion",
"length_affects_penetrance",
"length_affects_severity"
] | [] | [
"pmid:11246464",
"omim:309548",
"pmid:16205714",
"pmid:36169768",
"genereviews:NBK535148",
"pmid:23914978",
"pmid:35245110",
"pmid:34111553",
"url:medlineplus.gov/genetics/condition/fragile-xe-syndrome",
"pmid:8334699",
"mondo:0010659"
] | [
"pmid:41074692",
"pmid:40708890",
"pmid:35431806",
"pmid:28812997",
"pmid:25171808",
"pmid:24763282",
"pmid:22718980",
"pmid:21739600",
"pmid:21254876",
"pmid:21051337",
"pmid:17635840",
"pmid:17516099",
"pmid:16469443",
"pmid:11119302",
"pmid:10780779",
"pmid:10674158",
"pmid:104248... |
FRA2A_AFF3 | FRA2A | AFF3 | [
"Definitive"
] | chr2 | 100,104,798 | 100,104,824 | 100,721,260 | 100,721,286 | 100,563,685 | 100,563,738 | Intellectual disability associated with fragile site FRA2A | [
"AD"
] | [
"Mendelian",
"Risk"
] | These expansions are associated with intellectual disability and clinical phenotypes such as delayed motor development or delays in speech/language [@pmid:24763282]. | null | null | 1/862 (1/654-1266) population prevalence of methylated AFF3 expansions (mild cognitive disability) [@pmid:39313615]. Disease cases observed in South Australia [@pmid:24763282]. | Early childhood (small sample size) [@pmid:24763282]. | 1 | 7 | null | null | Allele ranges established in study of 3 families; intermediate alleles likely premutations [@pmid:24763282]. Pathogenic threshold may be higher than 300 as this was the largest allele that could be accurately sized by the assay. | Standard PCR has detected small alleles, while RP-PCR and Southern blotting have detected large expansions. Short-read sequencing may underestimate the size of large expansions and exact sizing usually uses long-read sequencing [@pmid:24763282; @pmid:39313615]. | LoF/methylation | Silencing of the FMR2 gene as a consequence of a CCG expansion located upstream of this gene [@malacard:KNS007]. | 2014 [@pmid:24763282] | Intron 3 | - | [
"CCG"
] | [
"CCG"
] | [] | [] | [] | [
"CGG"
] | [] | [] | [] | [] | 3 | 20 | null | null | 300 | 300 | 3 | 8.7 | ref | [] | [] | [
"KNS007"
] | [] | [] | [
"601464"
] | [] | [
"AFF3"
] | [] | [
"TR252468"
] | [
"288936"
] | [] | [] | [] | [
"pmid:24763282",
"malacard:KNS007",
"pmid:39313615"
] | [
"pmid:40417743",
"pmid:37205357"
] |
SBMA_AR | SBMA | AR | [
"Definitive"
] | chrX | 67,545,316 | 67,545,419 | 66,765,158 | 66,765,261 | 65,975,147 | 65,975,250 | Spinal and bulbar muscular atrophy, Kennedy Disease | [
"XR"
] | [
"Mendelian"
] | Kennedy's disease, also known as bulbospinal muscular atrophy (BSMA), is a rare X-linked recessive motor neuron disease characterized by proximal and bulbar muscle wasting [@mondo:0010735]. | [
"HP:0000029 Testicular atrophy",
"HP:0000144 Decreased fertility",
"HP:0000153 Abnormality of the mouth",
"HP:0000763 Sensory neuropathy",
"HP:0000771 Gynecomastia",
"HP:0001252 Hypotonia",
"HP:0001260 Dysarthria",
"HP:0001265 Hyporeflexia",
"HP:0001283 Bulbar palsy",
"HP:0001288 Gait disturbance"... | 1/30000 | 1-2/100,000 (population-specific, higher in Finnish population, Canadian population) [@pmid:37628685]; 1/30,000 [@orphanet:481]; mutation frequency of 1:3182 10x more frequent than reported disease prevalence of 1 in 30,000 [@pmid:36797998]. Only documented in patients with European/Asian ancestry, including Scandinavi... | Typical: 20-49 [@pmid:11436124]; Range: 8 [@pmid:15851746] - 83 [@doi:10.17161/2tmg0f25]. | 8 | 83 | 20 | 49 | Intermediate alleles indicate reduced penetrance [@genereviews:NBK1333]. Expansions larger than the pathogenic threshold in the AR gene should be evaluated carefully. Interruptions have not been observed in patient cases; it has been proposed that longer alleles with interruptions may not be pathogenic [@pmid:24041967]... | Although short-read sequencing screens have been used to detect this expansion [@pmid:36797998], sizing is generally validated with standard PCR fragment analysis or RP-PCR [@genereviews:NBK1333]. | GoF | Polyglutamine alters protein conformation leading to gain-of-function neurodegeneration [@pmid:29398703; @pmid:36169768]. Transcriptional dysregulation, axonal transport disruption, and mitochondrial dysfunction also play causative roles in the neurodegeneration [@pmid:22609045]. | 1991 [@pmid:2062380]; the first triplet disease to be discovered [@pmid:15313856] | Coding Exon 1 | + | [
"CAG"
] | [
"CAG"
] | [] | [] | [] | [
"CAG"
] | [] | [] | [] | [] | 9 | 34 | 36 | 37 | 38 | 68 | 3 | 34 | ref | [
"6818"
] | [
"NBK1333"
] | [
"SPN404"
] | [
"333282"
] | [
"0010735"
] | [
"313200"
] | [
"481"
] | [
"AR"
] | [
"AR"
] | [
"TR169377"
] | [
"859199"
] | [] | [
"contraction",
"somatic_instability",
"anticipation",
"paternal_expansion",
"length_affects_severity",
"length_affects_penetrance",
"length_affects_onset"
] | [] | [
"pmid:11436124",
"pmid:15851746",
"doi:10.17161/2tmg0f25",
"pmid:29398703",
"pmid:36169768",
"pmid:22609045",
"genereviews:NBK1333",
"pmid:24041967",
"pmid:35245110",
"pmid:36797998",
"pmid:10398229",
"pmid:34922802",
"pmid:20184516",
"pmid:37628685",
"orphanet:481",
"pmid:37578398",
... | [
"pmid:42538437",
"pmid:42485097",
"pmid:42436779",
"pmid:42412610",
"pmid:42411473",
"pmid:42396269",
"pmid:42239750",
"pmid:42196324",
"pmid:42138244",
"pmid:42070078",
"pmid:42067676",
"pmid:41762523",
"pmid:41564929",
"pmid:41552385",
"pmid:41513898",
"pmid:41361869",
"pmid:412469... |
EIEE1_ARX | EIEE1 | ARX | [
"Definitive"
] | chrX | 25,013,649 | 25,013,697 | 25,031,766 | 25,031,814 | 24,597,886 | 24,597,934 | Early-infantile epileptic encephalopathy | [
"XR"
] | [
"Mendelian"
] | Developmental and epileptic encephalopathy-1 (DEE1) is a severe form of epilepsy characterized by frequent tonic seizures or spasms beginning in infancy with a specific EEG finding of suppression-burst patterns, characterized by high-voltage bursts alternating with almost flat suppression phases [@omim:308350]. | [
"HP:0000054 Micropenis",
"HP:0000252 Microcephaly",
"HP:0000568 Microphthalmia",
"HP:0000817 Reduced eye contact",
"HP:0001249 Intellectual disability",
"HP:0001263 Global developmental delay",
"HP:0001266 Choreoathetosis",
"HP:0001276 Hypertonia",
"HP:0001285 Spastic tetraparesis",
"HP:0001332 Dy... | null | Found in individuals of multiple ethnicities, including European and Asian ancestry [@pmid:12874418]. | Typical: 0 [@pmid:21204215; @pmid:9307258]; Range: 0-4; 70% of cases involve infantile spasms, leading to seizures by 3 or 4 years [@pmid:19587282]. | 0 | 4 | 0 | 0 | ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:3002... | Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:17668384]. | LoF | Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mislocalization of mutant protein, increased with expansion length [@genereviews:NBK51932]. | 2002 [@pmid:11889467] | Coding Exon 2, aa 110-115 | - | [
"GCN"
] | [
"NGC"
] | [] | [] | [] | [
"GCN"
] | [] | [] | [] | [] | 10 | 16 | null | null | 17 | 27 | 3 | 14.7 | ref | [
"15298"
] | [
"NBK535148"
] | [
"ERL057"
] | [
"483052"
] | [
"0010632"
] | [
"308350",
"300419",
"300215"
] | [
"182079"
] | [
"ARX_1"
] | [
"ARX_1"
] | [
"TR167317"
] | [
"843651"
] | [
"STR_1542607"
] | [
"length_affects_phenotype"
] | [
"phenotypic_spectrum"
] | [
"pmid:21204215",
"pmid:9307258",
"pmid:19587282",
"pmid:36169768",
"pmid:38467784",
"genereviews:NBK51932",
"genereviews:NBK535148",
"omim:309510",
"omim:308350",
"omim:300004",
"omim:300215",
"pmid:26029707",
"pmid:20506206",
"pmid:12874418",
"pmid:11889467"
] | [
"pmid:40608247",
"pmid:39933386",
"pmid:39123069",
"pmid:36571524",
"pmid:33847015",
"pmid:32033960",
"pmid:28627419",
"pmid:28602636",
"pmid:27798109",
"pmid:26571108",
"pmid:25171319",
"pmid:24236044",
"pmid:23968833",
"pmid:23246292",
"pmid:22628459",
"pmid:22108177",
"pmid:203764... |
PRTS_ARX | PRTS | ARX | [
"Definitive"
] | chrX | 25,013,529 | 25,013,565 | 25,031,646 | 25,031,682 | 24,597,766 | 24,597,802 | Partington syndrome | [
"XR"
] | [
"Mendelian"
] | A rare neurological condition that is primarily characterized by mild to moderate intellectual disability and dystonia of the hands. Other signs and symptoms may include dysarthria, behavioral abnormalities, recurrent seizures and/or an unusual gait (style of walking). Partington syndrome usually occurs in males; when ... | [
"HP:0000053 Macroorchidism",
"HP:0000325 Triangular face",
"HP:0000708 Atypical behavior",
"HP:0000750 Delayed speech and language development",
"HP:0001249 Intellectual disability",
"HP:0001250 Seizure",
"HP:0001256 Mild intellectual disability",
"HP:0001260 Dysarthria",
"HP:0001288 Gait disturbanc... | null | Limited clinical cases of predominantly European ancestry, such as Welsh/Belgian [@omim:309510]. | Typical: 1-3; Range: 0-4. Mild phenotypes can make diagnosis difficult (expansions are particularly mild/absent in females) [@omim:309510]. | 0 | 4 | null | null | ARX expansions [@genereviews:NBK535148] result in a phenotypic spectrum of conditions including Partington syndrome [@omim:309510], Early Infantile Epileptic Encephalopathy [@omim:308350], Agenesis of Corpus Callosum with Abnormal Genitalia [@omim:300004], and X-Linked Lissencephaly with Ambiguous Genitalia [@omim:3002... | Because these are small coding expansions, they have been sized using targeted exon 2 PCR with fragment analysis or targeted Sanger sequencing [@pmid:11889467]. | LoF | Polyalanine expansions lead to reduction in protein product through unclear mechanism [@pmid:36169768; @pmid:38467784]. Apparent aggregation and mislocalization of mutant protein, increased with expansion length [@genereviews:NBK51932]. | 2002 [@pmid:11889467] | Coding Exon 2, aa 144-155 | - | [
"GCN"
] | [
"NGC"
] | [] | [] | [] | [
"GCN"
] | [] | [] | [] | [] | 12 | 12 | null | null | 20 | 20 | 3 | 12 | ref | [
"4235"
] | [
"NBK535148"
] | [
"PRT003"
] | [
"163237"
] | [
"0010654"
] | [
"309510"
] | [
"94083"
] | [
"ARX_2"
] | [
"ARX_2"
] | [
"TR167316"
] | [] | [] | [
"length_affects_phenotype"
] | [
"phenotypic_spectrum"
] | [
"omim:309510",
"pmid:36169768",
"pmid:38467784",
"genereviews:NBK51932",
"genereviews:NBK535148",
"omim:308350",
"omim:300004",
"omim:300215",
"pmid:26029707",
"pmid:20506206",
"pmid:11889467",
"mondo:0010654"
] | [
"pmid:40608247",
"pmid:39933386",
"pmid:39123069",
"pmid:36571524",
"pmid:33847015",
"pmid:32033960",
"pmid:28627419",
"pmid:28602636",
"pmid:27798109",
"pmid:26571108",
"pmid:25171319",
"pmid:24236044",
"pmid:23968833",
"pmid:23246292",
"pmid:22628459",
"pmid:22108177",
"pmid:212042... |
DRPLA_ATN1 | DRPLA | ATN1 | [
"Definitive"
] | chr12 | 6,936,716 | 6,936,775 | 7,045,879 | 7,045,938 | 6,947,903 | 6,947,941 | Dentatorubral-Pallidoluysian Atrophy | [
"AD"
] | [
"Mendelian"
] | Dentatorubral pallidoluysian atrophy (DRPLA) is a rare subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by involuntary movements, ataxia, epilepsy, mental disorders, cognitive decline and prominent anticipation [@mondo:0007435]. Epilepsy is common in earlier onset cases [@pmid:4... | [
"HP:0000597 Ophthalmoparesis",
"HP:0000639 Nystagmus",
"HP:0000643 Blepharospasm",
"HP:0000726 Dementia",
"HP:0001138 Optic neuropathy",
"HP:0001152 Saccadic smooth pursuit interruptions",
"HP:0001249 Intellectual disability",
"HP:0001250 Seizure",
"HP:0001251 Ataxia",
"HP:0001260 Dysarthria",
"... | 4.5/1000000 | 2-7/1,000,000. More prevalent in Japanese populations; also reported in North America, South America, Europe, and Australia [@genereviews:NBK1491]. | Typical: 20-40 [@pmid:6808417; @genereviews:NBK1491]. Range: 0 [@pmid:11160976] - 72 [@genereviews:NBK1491]. | 0 | 72 | 20 | 40 | Pathogenic expansions (48-93) are fully penetrant with the exception of one documented case of 51 repeats; intermediate alleles (36-47) are associated with a milder phenotype and can expand upon transmission [@genereviews:NBK1491]. CAA interruptions have been observed without known clinical association [@pmid:35245110]... | PCR fragment analysis has detected most moderate alleles, but Southern blotting or RP-PCR have been used in cases of large expansions or when PCR shows an apparently homozygous small allele, to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1491]. | GoF | Polyglutamine expansions leading to gain of function [@genereviews:NBK1491]. | 1994 [@pmid:7842016] | Coding Exon 5 | + | [
"CAG"
] | [
"CAG"
] | [] | [] | [] | [
"CAG"
] | [] | [] | [] | [] | 6 | 35 | 36 | 47 | 48 | 93 | 3 | 19 | ref | [
"5643"
] | [
"NBK1491"
] | [
"DNT005"
] | [
"155630"
] | [
"0007435"
] | [
"125370"
] | [
"101"
] | [
"ATN1"
] | [
"ATN1"
] | [
"TR114246"
] | [
"5050156"
] | [
"Expansion_ATN1/DRPLA"
] | [
"anticipation",
"somatic_instability",
"paternal_expansion",
"length_affects_onset",
"length_affects_severity",
"length_affects_phenotype"
] | [
"ataxia",
"epilepsy"
] | [
"pmid:6808417",
"genereviews:NBK1491",
"pmid:11160976",
"pmid:35245110",
"pmid:41147955",
"pmid:42359808",
"pmid:7842016",
"mondo:0007435"
] | [
"pmid:42196324",
"pmid:41624332",
"pmid:41355374",
"pmid:41254939",
"pmid:41082794",
"pmid:40832356",
"pmid:40488180",
"pmid:40450087",
"pmid:40340521",
"pmid:40298952",
"pmid:40263757",
"pmid:40237283",
"pmid:39820777",
"pmid:39812846",
"pmid:39742457",
"pmid:39224955",
"pmid:389618... |
SCA1_ATXN1 | SCA1 | ATXN1 | [
"Definitive"
] | chr6 | 16,327,633 | 16,327,724 | 16,327,864 | 16,327,955 | 16,200,188 | 16,200,282 | Spinocerebellar ataxia type 1 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 1 (SCA1) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by dysarthria, writing difficulties, limb ataxia, and commonly nystagmus and saccadic abnormalities [@mondo:0008119]. | [
"HP:0000496 Abnormality of eye movement",
"HP:0000514 Slow saccadic eye movements",
"HP:0000543 Optic disc pallor",
"HP:0000597 Ophthalmoparesis",
"HP:0000623 Supranuclear ophthalmoplegia",
"HP:0000639 Nystagmus",
"HP:0000640 Gaze-evoked nystagmus",
"HP:0000641 Dysmetric saccades",
"HP:0000648 Optic... | 1.5/100000 | 1-2/100,000. Cases have been reported worldwide, although prevalence varies by ancestry/ethnicity [@genereviews:NBK1184]. | Typical: 20-39 [@url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias]; Range: 6 [@pmid:3165612] - 63 [@pmid:8825276]. | 6 | 63 | 20 | 39 | Penetrance is dependent on sequence purity in addition to expansion length: pure repeats are pathogenic at 39 repeats [@pmid:37906407], while CAT interruptions [@pmid:35245110] can lead to reduced penetrance at comparable lengths [@genereviews:NBK1184]. Regardless, intermediate alleles are considered premutations which... | PCR fragment analysis is commonly used for sizing [@genereviews:NBK1184]. Standard fragment analysis does not resolve CAT interruptions, which require targeted analysis like RP-PCR or Sanger sequencing [@pmid:34635619; @genereviews:NBK1184]. | GoF/LoF | Polyglutamine expansion leading to toxic gain of function with eventual misregulation-based loss of function/dominant negative [@genereviews:NBK1184; @pmid:35573049]. | 1993 [@pmid:8358429] | Coding Exon 8 | - | [
"CTG"
] | [
"CTG"
] | [] | [] | [
"GAT",
"TTG"
] | [
"CAG"
] | [] | [] | [
"ATC",
"CAA"
] | [] | 6 | 35 | 36 | 38 | 39 | 91 | 3 | 30.3 | ref | [
"4071"
] | [
"NBK1184"
] | [
"SPN294"
] | [
"155703"
] | [
"0008119"
] | [
"164400"
] | [
"98755"
] | [
"ATXN1"
] | [
"ATXN1"
] | [
"TR63118"
] | [
"5767842"
] | [
"Expansion_SCA1/ATXN1"
] | [
"somatic_instability",
"anticipation",
"paternal_expansion",
"length_affects_onset",
"length_affects_penetrance",
"length_affects_severity",
"motif_affects_instability",
"motif_affects_onset",
"motif_affects_penetrance",
"motif_affects_severity"
] | [
"spinocerebellar_ataxia"
] | [
"url:https://www.uptodate.com/contents/autosomal-dominant-spinocerebellar-ataxias",
"pmid:3165612",
"pmid:8825276",
"genereviews:NBK1184",
"pmid:35573049",
"pmid:37906407",
"pmid:35245110",
"pmid:23935513",
"pmid:8358429",
"mondo:0008119"
] | [
"pmid:42396269",
"pmid:42196324",
"pmid:41727128",
"pmid:41435767",
"pmid:41426430",
"pmid:41254939",
"pmid:41149812",
"pmid:40900235",
"pmid:40488180",
"pmid:40450087",
"pmid:39820777",
"pmid:39456985",
"pmid:39289638",
"pmid:39211226",
"pmid:38961870",
"pmid:38626762",
"pmid:385856... |
SCA10_ATXN10 | SCA10 | ATXN10 | [
"Definitive"
] | chr22 | 45,795,354 | 45,795,424 | 46,191,234 | 46,191,304 | 46,280,059 | 46,280,134 | Spinocerebellar ataxia type 10 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 10 (SCA10) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I). It is characterized by slowly progressive cerebellar syndrome and epilepsy, sometimes mild pyramidal signs, peripheral neuropathy and neuropsychological disturbances [@mondo:0011330]. | [
"HP:0000012 Urinary urgency",
"HP:0000020 Urinary incontinence",
"HP:0000639 Nystagmus",
"HP:0000640 Gaze-evoked nystagmus",
"HP:0000716 Depression",
"HP:0000718 Aggressive behavior",
"HP:0000726 Dementia",
"HP:0000741 Apathy",
"HP:0000762 Decreased nerve conduction velocity",
"HP:0001250 Seizure"... | null | Unknown prevalence, >300 individuals. Cases have been identified in Mexico, Brazil, China, Guatemala, and Japan [@genereviews:NBK1175; @pmid:42320256]. | Typical: 12-48; Range: 11-83 [@genereviews:NBK1175]. | 11 | 83 | 12 | 48 | Unaffected individuals are usually (82%) compound heterozygotes in the benign range [@genereviews:NBK1175]. Intermediate alleles show reduced penetrance, and exact distinction between intermediate and the lower end of the pathogenic range is unclear [@genereviews:NBK1175]. Expansions are frequently interrupted by ATCCT... | RP-PCR with fragment analysis is commonly used for detection. Pathogenicity depends heavily on interruptions, so long-read sequencing approaches have been used for full structure resolution [@pmid:26295943; @pmid:32160188]. | GoF | Transdominant mechanism theorized [@pmid:38467784]. | 2000 [@pmid:11017075] | Intron 9 | + | [
"ATTCT"
] | [
"ATTCT"
] | [] | [] | [
"ATCCT",
"ATCCC",
"ATTCC",
"ATTTCT",
"ATATTCT",
"ATTCTTCT",
"ATTGT",
"CTTTT",
"ATTTTCT",
"ATTCTCT",
"CTGTTT",
"CTCTT",
"ATGCT"
] | [
"ATTCT"
] | [] | [] | [
"ATCCT",
"ATCCC",
"ATTCC",
"ATTTCT",
"ATATTCT",
"ATTCTTCT",
"ATTGT",
"CTTTT",
"ATTTTCT",
"ATTCTCT",
"CTGTTT",
"CTCTT",
"ATGCT"
] | [] | 10 | 32 | 33 | 850 | 800 | 4,500 | 5 | 14 | ref | [
"10474"
] | [
"NBK1175"
] | [
"SPN314"
] | [
"369786"
] | [
"0011330"
] | [
"603516"
] | [
"98761"
] | [
"ATXN10"
] | [
"ATXN10"
] | [
"TR165509"
] | [
"1027359",
"4921433"
] | [
"STR_909210"
] | [
"somatic_instability",
"anticipation",
"paternal_expansion",
"length_affects_onset",
"length_affects_penetrance",
"length_affects_phenotype",
"motif_affects_instability",
"motif_affects_penetrance",
"motif_affects_phenotype"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK1175",
"pmid:38467784",
"pmid:36199580",
"pmid:19234597",
"pmid:24318420",
"pmid:41229449",
"pmid:36092952",
"pmid:42320256",
"pmid:11017075",
"mondo:0011330"
] | [
"pmid:41074692",
"pmid:40900235",
"pmid:40898875",
"pmid:40488180",
"pmid:40067487",
"pmid:39820777",
"pmid:38961870",
"pmid:38832639",
"pmid:35103298",
"pmid:34970537",
"pmid:33502644",
"pmid:32520333",
"pmid:32160188",
"pmid:31737797",
"pmid:31445906",
"pmid:31342269",
"pmid:299229... |
SCA2_ATXN2 | SCA2 | ATXN2 | [
"Definitive"
] | chr12 | 111,598,949 | 111,599,019 | 112,036,753 | 112,036,823 | 111,575,873 | 111,575,940 | Spinocerebellar ataxia type 2 | [
"AD",
"AR"
] | [
"Mendelian",
"Risk",
"Modifier"
] | A subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by truncal ataxia, dysarthria, slowed saccades and less commonly ophthalmoparesis and chorea [@mondo:0008458]. | [
"HP:0000020 Urinary incontinence",
"HP:0000510 Rod-cone dystrophy",
"HP:0000514 Slow saccadic eye movements",
"HP:0000597 Ophthalmoparesis",
"HP:0000602 Ophthalmoplegia",
"HP:0000623 Supranuclear ophthalmoplegia",
"HP:0000639 Nystagmus",
"HP:0000640 Gaze-evoked nystagmus",
"HP:0000641 Dysmetric sacc... | 1.5/100000 | 1-2/100,000 (population-dependent) [@pmid:29100084]. Cases have been found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1275]. | Typical: 30-39 [@genereviews:NBK1275]; Range: 2-86 [@omim:183090]. | 2 | 86 | 30 | 39 | Full penetrance of single alleles occurs at ~35 repeats [@genereviews:NBK1275; @pmid:37906407] and pathogenic expansions have been documented as large as 500 repeats [@pmid:12116207]. 33-34 length repeats are associated with reduced penetrance and later onset (age >50 years) [@genereviews:NBK1275]. Homozygous 31 repeat... | RP-PCR with fragment analysis is commonly used for detection, while Southern blotting is required to estimate size over 100 repeats [@genereviews:NBK1275]. | GoF/LoF | Polyglutamine cytoplasmic aggregates leading to cellular apoptosis; RAN translation implicated [@genereviews:NBK1275]. | 1996 [@pmid:8896556] | Coding Exon 1 | - | [
"CTG"
] | [
"CTG"
] | [] | [] | [
"TTG"
] | [
"CAG"
] | [] | [] | [
"CAA"
] | [] | 14 | 28 | 29 | 34 | 35 | 500 | 3 | 23.3 | ref | [
"4072"
] | [
"NBK1275"
] | [
"SPN301"
] | [
"155704"
] | [
"0008458"
] | [
"183090"
] | [
"98756"
] | [
"ATXN2"
] | [
"ATXN2"
] | [
"TR120465"
] | [
"598560",
"5117050"
] | [
"Expansion_SCA2/ATXN2"
] | [
"somatic_instability",
"anticipation",
"paternal_expansion",
"maternal_expansion",
"length_affects_onset",
"length_affects_penetrance",
"length_affects_phenotype",
"length_affects_severity",
"motif_affects_instability",
"motif_affects_phenotype",
"proposed_modifier"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK1275",
"omim:183090",
"pmid:37906407",
"pmid:12116207",
"pmid:30533529",
"pmid:25285812",
"pmid:32954321",
"pmid:39956874",
"pmid:24122064",
"pmid:29100084",
"pmid:8896556",
"mondo:0008458"
] | [
"pmid:42539086",
"pmid:42512530",
"pmid:42501220",
"pmid:42396269",
"pmid:42204920",
"pmid:42196324",
"pmid:42096001",
"pmid:42087256",
"pmid:42060068",
"pmid:42019185",
"pmid:41912844",
"pmid:41876820",
"pmid:41771688",
"pmid:41728197",
"pmid:41693683",
"pmid:41683965",
"pmid:416309... |
SCA3_ATXN3 | SCA3, MJD | ATXN3 | [
"Definitive"
] | chr14 | 92,071,010 | 92,071,052 | 92,537,354 | 92,537,396 | 86,300,519 | 86,300,603 | Spinocerebellar ataxia type 3/Machado-Joseph disease | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 3 (SCA3), also known as Machado-Joseph disease, is the most common subtype of type 1 autosomal dominant cerebellar ataxia (ADCA type 1), a neurodegenerative disorder, and is characterized by ataxia, external progressive ophthalmoplegia, and other neurological manifestations [@mondo:0007182].... | [
"HP:0000508 Ptosis",
"HP:0000520 Proptosis",
"HP:0000544 External ophthalmoplegia",
"HP:0000590 Progressive external ophthalmoplegia",
"HP:0000623 Supranuclear ophthalmoplegia",
"HP:0000639 Nystagmus",
"HP:0000640 Gaze-evoked nystagmus",
"HP:0000641 Dysmetric saccades",
"HP:0000651 Diplopia",
"HP:... | 2.1/100000 | 1-5/100,000 [@pmid:29100084]. Most prevalent SCA subtype [@genereviews:NBK557816]. Found worldwide across ancestries/ethnicities [@genereviews:NBK1196]. | Typical: 10-49 [@genereviews:NBK1196]; 3 [@pmid:40004498] - 73 [@genereviews:NBK1196; @pmid:30414314]. | 3 | 73 | 10 | 49 | Benign alleles range from 11-44 repeats [@pmid:37906407], with intermediate alleles (45-59) associated with incomplete penetrance and non-classic phenotypes [@genereviews:NBK1196]. The threshold between incomplete and full penetrance is unclear, but presumed to occur at ~60 repeats [@genereviews:NBK1196; @pmid:37906407... | PCR fragment analysis or RP-PCR typically detect expansions, but homozygous PCR results may require Southern blotting to exclude allelic dropout of a larger expansion that failed to amplify [@genereviews:NBK1196]. Long-read sequencing can characterize full structure [@pmid:40890629]. | GoF | Polyglutamine expansion leading to gain of function; aggregated and mislocalized proteins in neurons [@pmid:36169768; @genereviews:NBK1196]. RAN translation has been demonstrated from the CUA/CUG transcript in cell-free and transfected-cell reporter systems [@pmid:42483834]. | 1994 [@pmid:7874163] | Coding Exon 10 | - | [
"CTG"
] | [
"CTG"
] | [] | [] | [
"TTG",
"AGG"
] | [
"CAG"
] | [] | [] | [
"CAA",
"CCT"
] | [] | 11 | 44 | 45 | 59 | 60 | 87 | 3 | 14 | ref | [
"6801"
] | [
"NBK1196"
] | [
"MCH002"
] | [
"9841"
] | [
"0007182"
] | [
"109150"
] | [
"98757"
] | [
"ATXN3"
] | [
"ATXN3"
] | [
"TR132758"
] | [
"5316666",
"1481402"
] | [
"Expansion_SCA3_MJD/ATXN3"
] | [
"somatic_instability",
"anticipation",
"paternal_expansion",
"maternal_expansion",
"length_affects_onset",
"length_affects_phenotype",
"length_affects_severity"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK1196",
"pmid:40004498",
"pmid:30414314",
"pmid:36169768",
"pmid:37906407",
"pmid:35245110",
"pmid:39731318",
"pmid:39699045",
"pmid:29100084",
"genereviews:NBK557816",
"pmid:7874163",
"mondo:0007182",
"pmid:40684213"
] | [
"pmid:42538636",
"pmid:42512530",
"pmid:42439334",
"pmid:42403360",
"pmid:42396269",
"pmid:42337487",
"pmid:42320256",
"pmid:42251968",
"pmid:42191105",
"pmid:42105168",
"pmid:42096001",
"pmid:41854058",
"pmid:41853947",
"pmid:41818480",
"pmid:41771688",
"pmid:41736717",
"pmid:417137... |
SCA7_ATXN7 | SCA7 | ATXN7 | [
"Definitive"
] | chr3 | 63,912,684 | 63,912,715 | 63,898,360 | 63,898,391 | 63,956,302 | 63,956,333 | Spinocerebellar ataxia type 7 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia-7 (SCA7) is an autosomal dominant neurodegenerative disorder characterized by adult onset of progressive cerebellar ataxia associated with pigmental macular dystrophy [@omim:164500]. | [
"HP:0000514 Slow saccadic eye movements",
"HP:0000529 Progressive visual loss",
"HP:0000548 Cone/cone-rod dystrophy",
"HP:0000572 Visual loss",
"HP:0000580 Pigmentary retinopathy",
"HP:0000597 Ophthalmoparesis",
"HP:0000602 Ophthalmoplegia",
"HP:0000608 Macular degeneration",
"HP:0000613 Photophobia... | 0.999/300000 | <1/300,000: predominantly found in those with North European and African ancestry [@genereviews:NBK1256]. | Typical: 4-48 [@pmid:20739808]; Range: 0-92 [@genereviews:NBK1256; @pmid:14571264]. | 0 | 92 | 4 | 48 | Benign alleles range from 4-27 [@pmid:37906407], with intermediate alleles ranging from premutations (28-33) to reduced penetrance (34-36) [@genereviews:NBK1256]. Interruptions observed include CAA [@pmid:35245110]. CAG repeat expansions have been detected in a circular RNA (circATXN7(3,4).1) derived from this locus, i... | Short-read WGS cannot accurately detect repeat expansions at this locus. PCR fragment analysis or RP-PCR has detected expansions and sized most normal or moderate pathogenic alleles, while very large expansions have been detected with Southern blotting or long-read sequencing [@genereviews:NBK1256]. | GoF | Polyglutamine expansion leading to gain of function; toxic misfolded intermediate suspected [@genereviews:NBK1256; @pmid:18418675]. | 1996 [@pmid:8908515] | Coding Exon 1, 2, or 3 (depending on isoform) | + | [
"CAG"
] | [
"CAG"
] | [] | [] | [] | [
"CAG"
] | [] | [] | [] | [
{
"motif": "CAG",
"count": null,
"type": "pathogenic_repeat"
},
{
"motif": "CCG",
"count": 4,
"type": "flank_repeat"
}
] | 4 | 27 | 28 | 35 | 37 | 460 | 3 | 10.7 | ref | [
"20405"
] | [
"NBK1256"
] | [
"SPN291"
] | [
"156006"
] | [
"0016163"
] | [
"164500"
] | [
"94147"
] | [
"ATXN7"
] | [
"ATXN7"
] | [
"TR31879",
"TR31880"
] | [
"4965588"
] | [
"Expansion_SCA7/ATXN7"
] | [
"somatic_instability",
"anticipation",
"paternal_expansion",
"length_affects_onset",
"length_affects_penetrance",
"length_affects_phenotype",
"length_affects_severity"
] | [
"spinocerebellar_ataxia"
] | [
"pmid:20739808",
"genereviews:NBK1256",
"pmid:14571264",
"pmid:18418675",
"pmid:37906407",
"pmid:35245110",
"pmid:42340810",
"pmid:8908515",
"omim:164500"
] | [
"pmid:42512530",
"pmid:42264098",
"pmid:41771688",
"pmid:41254939",
"pmid:40900235",
"pmid:40488180",
"pmid:40417743",
"pmid:39820777",
"pmid:39649105",
"pmid:39571249",
"pmid:39504355",
"pmid:39317855",
"pmid:39053472",
"pmid:38961870",
"pmid:38906973",
"pmid:38851031",
"pmid:386739... |
SCA8_ATXN8OS | SCA8 | ATXN8OS | [
"Definitive"
] | chr13 | 70,139,383 | 70,139,429 | 70,713,515 | 70,713,561 | 69,361,243 | 69,361,270 | Spinocerebellar ataxia type 8 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 8 (SCA8) is a subtype of type I autosomal dominant cerebellar ataxia (ADCA type I) characterized by cerebellar ataxia and cognitive dysfunction in almost three quarters of patients and pyramidal and sensory signs in approximately a third of patients [@mondo:0012116]. | [
"HP:0000020 Urinary incontinence",
"HP:0000273 Facial grimacing",
"HP:0000514 Slow saccadic eye movements",
"HP:0000639 Nystagmus",
"HP:0000641 Dysmetric saccades",
"HP:0000716 Depression",
"HP:0000763 Sensory neuropathy",
"HP:0000802 Impotence",
"HP:0001251 Ataxia",
"HP:0001257 Spasticity",
"HP... | 0.5/100000 | <1/100,000 [@pmid:29100084]; expansion in 1:100-1200 chromosomes [@genereviews:NBK1268]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1268]. | Typical: third to fifth decade (20-49); Range: 0 [@genereviews:NBK1268] - 76 [@pmid:40015980]. | 0 | 76 | 20 | 49 | Two genes span the CTG/CAG repeat and are expressed in opposite directions: ATXN8, a nearly pure polyglutamine repeat protein in the CAG direction, and ATXN8OS, which is transcribed to a noncoding CUG repeat RNA [@pmid:16804541]. Reduced penetrance is found in alleles of all sizes, although penetrance appears higher at... | Short-read sequencing has been reported to underestimate expansion size [@pmid:40015980; @genereviews:NBK1268]. RP-PCR has detected large expansions while long-read sequencing and Southern blotting estimated size more accurately [@genereviews:NBK1268]. | GoF | Polyglutamine/toxic gain-of-function [@omim:608768; @genereviews:NBK1268]. | 1999 [@pmid:10192387] | Coding Exon 1, or 3' UTR depending on transcript | + | [
"CTG"
] | [
"CTG"
] | [] | [] | [
"CCG",
"ACT",
"CCT",
"ACC",
"CTT"
] | [
"CTG"
] | [] | [] | [
"CCG",
"ACT",
"CCT",
"ACC",
"CTT"
] | [
{
"motif": "CTA",
"count": 10,
"type": "flank_repeat"
},
{
"motif": "CTG",
"count": null,
"type": "pathogenic_repeat"
}
] | 15 | 50 | 50 | 70 | 71 | 1,300 | 3 | 15.3 | ref | [
"4956"
] | [
"NBK1268"
] | [
"SPN304"
] | [
"332457"
] | [
"0012116"
] | [
"608768"
] | [
"98760"
] | [
"ATXN8OS"
] | [
"ATXN8OS"
] | [
"TR125263",
"TR125264"
] | [
"5356762"
] | [
"Expansion_SCA8/ATXN8"
] | [
"somatic_instability",
"anticipation",
"maternal_expansion",
"motif_affects_onset",
"motif_affects_penetrance"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK1268",
"pmid:40015980",
"omim:608768",
"pmid:16804541",
"pmid:20373340",
"pmid:28451643",
"pmid:34632710",
"pmid:29100084",
"pmid:10192387",
"mondo:0012116"
] | [
"pmid:42484951",
"pmid:42483834",
"pmid:42371259",
"pmid:42105044",
"pmid:42096001",
"pmid:42094143",
"pmid:41771688",
"pmid:41762523",
"pmid:41353794",
"pmid:41082794",
"pmid:41079917",
"pmid:41074692",
"pmid:41001200",
"pmid:40906330",
"pmid:40890648",
"pmid:40844737",
"pmid:407656... |
FRAXG_BCLAF3 | FRAXG | BCLAF3 | [
"Provisional"
] | chrX | 19,990,922 | 19,990,973 | 20,009,040 | 20,009,091 | 19,573,823 | 19,573,871 | Neurodevelopmental disorder associated with fragile site FRAXG | [
"XR"
] | [
"Mendelian"
] | Reported in a cohort of five males to date: intellectual disability was present in all, with epilepsy in at least 3/5 and autism spectrum disorder in at least 2/5 [@pmid:42482100]. Of the three males with long-read sequencing and DNA methylation validation, two carried an independent primary diagnosis (Williams syndrom... | null | null | null | Onset of intellectual disability and developmental delay is early childhood and not precisely datable. Range refers to seizure onset, which ranged from 2.9-6 years [@pmid:42482100]. | 2.9 | 6 | null | null | The lower-bound of the pathogenic allele size range is based on the TRGT consensus, with the upper bound determined by the maximum mosaic size observed in the cohort [@pmid:42482100]. ONT reads in affected individuals exhibited evidence of mosaicism from 280 up to 1238 motifs. Repeat purity is relevant to phenotype and... | Short-read sequencing with ExpansionHunter has detected expansion carriers as clear outliers but underestimates the true allele size roughly 5-15 fold and may miss CCA interruptions. Long-read sequencing can size expansions and resolve methylation status. Genome-wide DNA methylation arrays have accurately detected the ... | LoF | Expansion of the 5'UTR CCG repeat drives hypermethylation of the repeat and the surrounding CpG island and shore, coupled with a shift of the locus from open euchromatin (BRD4-positive) to closed heterochromatin (HP1a-positive) and loss of BCLAF3 RNA and protein. The expanded locus constitutes a folate-sensitive fragil... | 2026 [@pmid:42482100] | 5' UTR | - | [
"CCG"
] | [
"CCG"
] | [] | [] | [
"CCA"
] | [
"CGG"
] | [] | [] | [
"TGG"
] | [] | 5 | 23 | null | null | 482 | 1,238 | 3 | 17 | ref | [] | [] | [] | [] | [] | [
"301159"
] | [] | [] | [] | [
"TR167036"
] | [] | [] | [
"somatic_instability"
] | [
"epilepsy"
] | [
"pmid:42482100",
"url:https://api.semanticscholar.org/CorpusID:89799045",
"pmid:39107278"
] | [] |
SCA31_BEAN1 | SCA31 | BEAN1 | [
"Definitive"
] | chr16 | 66,490,396 | 66,490,466 | 66,524,299 | 66,524,369 | 72,284,666 | 72,284,761 | Spinocerebellar ataxia type 31 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 31 (SCA31) is a very rare subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by the late-onset of cerebellar ataxia, dysarthria and horizontal gaze nystagmus, and that is occasionally accompanied by pyramidal signs, tremor, decreased vibration sense and he... | [
"HP:0000365 Hearing impairment",
"HP:0000407 Sensorineural hearing impairment",
"HP:0000639 Nystagmus",
"HP:0001251 Ataxia",
"HP:0001257 Spasticity",
"HP:0001260 Dysarthria",
"HP:0001265 Hyporeflexia",
"HP:0001272 Cerebellar atrophy",
"HP:0001337 Tremor",
"HP:0001347 Hyperreflexia",
"HP:0002066 ... | null | Has been found in Japanese populations [@omim:117210], one Korean family and one Chinese family [@pmid:36563608]. | Typical: 56-62 [@pmid:36563608]; Range: 8-83 [@pmid:23331413]. | 8 | 83 | 56 | 62 | This locus is a novel STR-containing insertion, not present in reference genome; the pathogenic threshold (110-760) is based on the pure repeat of the pathogenic motif within the insertion [@pmid:19878914]. | RP-PCR has accurately detected this insertion [@pmid:22992774], while long-read sequencing has resolved size and motif architecture [@pmid:36289212]. | GoF | RNA toxicity and gain of function leading to neurodegeneration [@pmid:36371266]. Role in heterochromatin or chromosomal structure theorized [@omim:117210]. | 2009 [@pmid:19878914] | Intron 4/4 | + | [
"AATAA"
] | [
"AATGG",
"AATAG"
] | [] | [
"AAAAA",
"AAAAC",
"AAATG",
"AAAAG",
"AAGAT",
"AAACT",
"AACAT",
"AATAC",
"AAATC",
"AATGC"
] | [] | [
"AATGG",
"AATAG"
] | [] | [
"AAAAA",
"AAAAC",
"AAATG",
"AAAAG",
"AAGAT",
"AAACT",
"AACAT",
"AATAC",
"AAATC",
"AATGC"
] | [] | [] | null | null | null | null | 110 | 760 | 5 | 14.4 | novel | [
"9975"
] | [
"NBK535148"
] | [
"SPN103"
] | [
"348439"
] | [
"0007296"
] | [
"117210"
] | [
"217012"
] | [
"BEAN1"
] | [
"BEAN1"
] | [
"TR141992"
] | [
"812447",
"5971756"
] | [
"STR_539736"
] | [
"anticipation",
"motif_affects_onset",
"motif_affects_penetrance"
] | [
"spinocerebellar_ataxia"
] | [
"pmid:36563608",
"pmid:23331413",
"pmid:36371266",
"omim:117210",
"pmid:19878914",
"mondo:0007296"
] | [
"pmid:41841436",
"pmid:41426430",
"pmid:40765612",
"pmid:40488180",
"pmid:38961870",
"pmid:38152578",
"pmid:37848721",
"pmid:36970617",
"pmid:36092952",
"pmid:35084690",
"pmid:33785066",
"pmid:33431896",
"pmid:32066831",
"pmid:31737797",
"pmid:29111027",
"pmid:28343865",
"pmid:242150... |
FTDALS1_C9orf72 | FTDALS1 | C9orf72 | [
"Definitive"
] | chr9 | 27,573,484 | 27,573,546 | 27,573,482 | 27,573,544 | 27,584,063 | 27,584,155 | Frontotemporal dementia (FTD) and/or amyotrophic lateral sclerosis (ALS) | [
"AD"
] | [
"Mendelian",
"Risk"
] | Pure frontotemporal dementia, pure amyotrophic lateral sclerosis or combination of the two [@pmid:39349043]. Nominal associations with risk of Parkinson's have also been reported [@pmid:41074692]. May present as non-Huntington chorea in rare cases [@pmid:41957010]. | [
"HP:0000605 Supranuclear gaze palsy",
"HP:0000716 Depression",
"HP:0000726 Dementia",
"HP:0000738 Hallucinations",
"HP:0000741 Apathy",
"HP:0000746 Delusion",
"HP:0001260 Dysarthria",
"HP:0001300 Parkinsonism",
"HP:0001324 Muscle weakness",
"HP:0002059 Cerebral atrophy",
"HP:0002145 Frontotempor... | null | The expansion of a hexanucleotide repeat GGGGCC in C9orf72 is the most common known cause of ALS accounting for ~ 40% familial cases and ~ 7% sporadic cases in the European population; overall ALS incidence is 1-2/100,000 person-years, point prevalence is 3-5/100,000 (Europe/US); lifetime risk is 1 in 300 [@pmid:313156... | Typical: 50-64; Range: 20-91 [@genereviews:NBK268647]. | 20 | 91 | 50 | 64 | FTD and ALS form a clinical spectrum [@pmid:37388914; @pmid:22406228]. The clinical ranges of the C9orf72 locus remain ambiguous [@stripy:C9ORF72; @pmid:41951733]: most healthy controls have alleles up to 24 repeats [@pmid:28319737] yet 24-30 repeats are associated with ALS [@pmid:31315673] and while 60 repeats is freq... | Bidirectional RP-PCR is typically used for detection [@pmid:21944778]. Large pathogenic expansions are difficult to size exactly by PCR, so Southern blot is used to better estimate size [@pmid:23566336], while long-read sequencing provides direct sizing and sequence characterization [@pmid:30126445]. | GoF/LoF | Three overlapping mechanisms are supported: C9orf72 loss of function, RNA gain-of-function, and dipeptide repeat protein gain-of-function [@pmid:37847372]. Expansions are associated with reduced C9orf72 expression in multiple ALS tissues and altered splicing of the exon 1a isoform [@pmid:42145639]. The hexanucleotide r... | 2011 [@pmid:21944778] | Intron 1 or 5' UTR depending on transcript | - | [
"GGCCCC"
] | [
"CCCCGG"
] | [] | [] | [] | [
"CCGGGG"
] | [] | [] | [] | [] | 2 | 23 | 24 | 30 | 31 | 4,088 | 6 | 10.8 | ref | [
"18396"
] | [
"NBK268647"
] | [
"FRN044"
] | [
"1830423"
] | [
"0007105"
] | [
"105550"
] | [
"275872"
] | [
"C9ORF72"
] | [
"C9ORF72"
] | [
"TR92417"
] | [
"5877863",
"1502453"
] | [
"STR_1475506"
] | [
"length_affects_phenotype",
"length_affects_onset"
] | [
"phenotypic_spectrum"
] | [
"genereviews:NBK268647",
"pmid:37847372",
"pmid:42145639",
"omim:105500",
"pmid:24129584",
"pmid:24248382",
"pmid:23415312",
"pmid:23393093",
"pmid:40790269",
"pmid:36271076",
"pmid:34949835",
"pmid:42316301",
"pmid:39999167",
"pmid:37388914",
"pmid:22406228",
"stripy:C9ORF72",
"pmid... | [
"pmid:42539252",
"pmid:42536230",
"pmid:42479906",
"pmid:42441689",
"pmid:42418533",
"pmid:42412610",
"pmid:42367691",
"pmid:42331066",
"pmid:42314891",
"pmid:42302493",
"pmid:42296226",
"pmid:42221822",
"pmid:42211284",
"pmid:42147445",
"pmid:42135512",
"pmid:42087256",
"pmid:420332... |
SCA6_CACNA1A | SCA6 | CACNA1A | [
"Definitive"
] | chr19 | 13,207,858 | 13,207,898 | 13,318,672 | 13,318,712 | 13,333,136 | 13,333,176 | Spinocerebellar ataxia type 6 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 6 (SCA6) is the most common subtype of autosomal dominant cerebellar ataxia type III (ADCA type III) characterized by late-onset and slowly progressive gait ataxia and other cerebellar signs such as impaired muscle coordination and nystagmus [@mondo:0008457]. Ao et al. have proposed that thi... | [
"HP:0000504 Abnormality of vision",
"HP:0000639 Nystagmus",
"HP:0000643 Blepharospasm",
"HP:0000651 Diplopia",
"HP:0000763 Sensory neuropathy",
"HP:0001251 Ataxia",
"HP:0001260 Dysarthria",
"HP:0001272 Cerebellar atrophy",
"HP:0001310 Dysmetria",
"HP:0001332 Dystonia",
"HP:0001347 Hyperreflexia"... | 2.65/100000 | 13-15% of global SCA prevalence, estimated to be 0.02-31/100,000 [@genereviews:NBK1140; @pmid:29100084]: resultant estimate is 0.3-5/100,000. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1140]. | Typical: 43-52 [@genereviews:NBK1140]; Range: 16 [@pmid:23331413] - 73 [@genereviews:NBK1140]. | 16 | 73 | 43 | 52 | The intermediate range (19-20 motifs) [@pmid:39996131; @genereviews:NBK1140] can be associated with a premutation, reduced penetrance, atypical phenotype, or a disease state when homozygous [@genereviews:NBK1140]. When the longer allele is > 22 motifs, the short allele does not play a role in pathogenicity/age of onset... | Expansions have been detected by PCR fragment analysis [@pmid:35573049]. | GoF/LoF | Polyglutamine expansions associated with increased expression of altered product leading to impaired gene binding and transcription factor function as well as cellular toxicity [@genereviews:NBK1140]. | 1997 [@pmid:8988170] | Coding, Last Exon: 47 or 48 | - | [
"CTG"
] | [
"CTG"
] | [] | [] | [] | [
"CAG"
] | [] | [] | [] | [] | 4 | 18 | 19 | 20 | 21 | 33 | 3 | 13.3 | ref | [
"10351"
] | [
"NBK1140"
] | [
"SPN309"
] | [
"148458"
] | [
"0008457"
] | [
"183086"
] | [
"98758"
] | [
"CACNA1A"
] | [
"CACNA1A"
] | [
"TR154515"
] | [
"5624835"
] | [
"Expansion_SCA6/CACNA1A"
] | [
"length_affects_phenotype",
"length_affects_penetrance",
"length_affects_onset"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK1140",
"pmid:23331413",
"pmid:39996131",
"pmid:41951733",
"pmid:29100084",
"pmid:8988170",
"mondo:0008457",
"pmid:41358280"
] | [
"pmid:42396269",
"pmid:42337487",
"pmid:42196324",
"pmid:42038259",
"pmid:41771688",
"pmid:41762523",
"pmid:41082794",
"pmid:41009775",
"pmid:40906330",
"pmid:40900235",
"pmid:40879304",
"pmid:40746751",
"pmid:40488180",
"pmid:40189664",
"pmid:39812846",
"pmid:39571249",
"pmid:391527... |
JBS_CBL | JBS | CBL | [
"Definitive"
] | chr11 | 119,206,289 | 119,206,323 | 119,076,999 | 119,077,033 | 119,226,662 | 119,226,696 | Jacobsen syndrome (FRAX11B fragile site) | [
"AD"
] | [
"Mendelian"
] | A multiple congenital anomaly/intellectual disability contiguous gene syndrome caused by partial deletion of the long arm of chromosome 11 [@mondo:0007838]. | [
"HP:0000003 Multicystic kidney dysplasia",
"HP:0000023 Inguinal hernia",
"HP:0000028 Cryptorchidism",
"HP:0000047 Hypospadias",
"HP:0000060 Clitoral hypoplasia",
"HP:0000066 Labial hypoplasia",
"HP:0000126 Hydronephrosis",
"HP:0000174 Abnormal palate morphology",
"HP:0000238 Hydrocephalus",
"HP:00... | null | 1/100,000 births; female/male ratio 2:1 [@pmid:19267933]. Found across ancestries/ethnicities [@omim:147791]. | Condition at birth. | 0 | 0 | null | null | 70% of individuals have 11 repeats [@pmid:7603564], but pathogenic expansion can span hundreds of motifs [@pmid:10767345]. The CGG repeat expansion can lead to a fragile site and subsequent deletion of 11q (shown in 2 cases) but total causality is unclear; intermediate alleles are associated with a premutation [@pmid:1... | null | Hypermethylation | DNA hypermethylation/11q deletion in sporadic cases [@pmid:38467784]. | 1995 [@pmid:7603564] | 5' UTR | + | [
"CGG"
] | [
"CGG"
] | [] | [] | [] | [
"CGG"
] | [] | [] | [] | [] | 5 | 79 | 80 | 100 | 101 | 300 | 3 | 11.3 | ref | [
"307"
] | [] | [
"JCB001"
] | [
"162878"
] | [
"0007838"
] | [
"147791"
] | [
"2308"
] | [
"CBL"
] | [
"CBL"
] | [
"TR112816"
] | [
"6166081",
"430025"
] | [
"STR_266122"
] | [] | [] | [
"pmid:38467784",
"pmid:7603564",
"pmid:10767345",
"pmid:19267933",
"omim:147791",
"mondo:0007838"
] | [
"pmid:41964119",
"pmid:37422244",
"pmid:22131879",
"pmid:22084433",
"pmid:16474167"
] |
MODY8_CEL | MODY8 | CEL | [
"Provisional"
] | chr9 | 133,071,177 | 133,071,737 | 135,946,564 | 135,947,124 | 145,285,333 | 145,285,861 | Maturity-Onset Diabetes of the Young Type 8 | [
"AD"
] | [
"Mendelian"
] | Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts [@omim:609812]. Other types of this disease have been asso... | [
"HP:0001738 Exocrine pancreatic insufficiency",
"HP:0002027 Abdominal pain",
"HP:0003074 Hyperglycemia",
"HP:0004904 Maturity-onset diabetes of the young",
"HP:0040217 Elevated hemoglobin A1c"
] | null | Found in individuals of Danish and Norwegian ancestry [@pmid:16369531; @pmid:19760265]. | 11-17 [@pmid:19760265] | 11 | 17 | null | null | The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 [@pmid:34850019]. One report... | null | GoF | Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is la... | 2005 | Exon 11 | + | [
"GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG"
] | [
"ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC"
] | [] | [] | [] | [
"ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC"
] | [] | [] | [] | [
{
"motif": "GGCCCCCCCGTGCCGCCCACGGGTGACTCCGG",
"count": null,
"type": "pathogenic_repeat"
}
] | null | null | null | null | null | null | 33 | 17 | null | [] | [] | [
"MTR082"
] | [
"342845"
] | [
"0012348"
] | [
"609812"
] | [
"552"
] | [] | [] | [] | [] | [] | [
"contraction",
"motif_affects_pathogenicity"
] | [] | [
"pmid:19760265",
"pmid:21784842",
"pmid:27650499",
"pmid:33862081",
"pmid:38483348",
"pmid:34850019",
"pmid:39361122",
"pmid:16369531",
"omim:609812",
"genereviews:NBK500456",
"pmid:18544793"
] | [
"pmid:42525783",
"pmid:42418682",
"pmid:41894686",
"pmid:41057236",
"pmid:40840513",
"pmid:40641008",
"pmid:39710966",
"pmid:38473919",
"pmid:38458477",
"pmid:36379850",
"pmid:35583610",
"pmid:35215948",
"pmid:35156195",
"pmid:35082198",
"pmid:34507899",
"pmid:34100900",
"pmid:278023... |
DM2_CNBP | DM2 | CNBP | [
"Definitive"
] | chr3 | 129,172,576 | 129,172,656 | 128,891,419 | 128,891,499 | 131,917,482 | 131,917,557 | Myotonic dystrophy type 2 | [
"AD"
] | [
"Mendelian"
] | Myotonic dystrophy type 2 (MD2), also known as proximal myotonic myopathy, is a very rare genetic multi-system disorder of late childhood or adult-onset characterized by mild myotonia, muscle weakness, and rarely cardiac conduction disorders [@mondo:0011266]. | [
"HP:0000026 Male hypogonadism",
"HP:0000135 Hypogonadism",
"HP:0000407 Sensorineural hearing impairment",
"HP:0000518 Cataract",
"HP:0000798 Oligozoospermia",
"HP:0000975 Hyperhidrosis",
"HP:0001249 Intellectual disability",
"HP:0001262 Excessive daytime somnolence",
"HP:0001265 Hyporeflexia",
"HP... | 2.29/100000 | 2.29/100,000 [@pmid:35483324]; population specific prevalence [@genereviews:NBK1466]. Most cases have European ancestry, but disease has been reported worldwide [@genereviews:NBK1466]. | Typical: 28-56 [@pmid:29086017]; Range: 0-73 [@pmid:31159885]. | 0 | 73 | 28 | 56 | ≤30 uninterrupted CCTG repeats or 11-26 CCTG repeats with GCTC/TCTG interruptions are considered benign; 27-29 repeats with interruptions have currently unknown significance, ~30-~54 repeats are considered premutations, ~55-74 repeats are premutations with possible reduced penetrance, and >74 repeat alleles are conside... | Bidirectional RP-PCR and Southern blotting are commonly used for detection [@genereviews:NBK1466]. A downstream 3' (TCTG)n block can cause false negative or unclear results, so TCTG targeted RP-PCR or long-read sequencing has been used to resolve these cases [@pmid:36018009; @pmid:41937177]. | GoF | Aberrant splicing, RAN translation [@pmid:22140091; @pmid:38467784]. Proposed pathogenesis contributions include nucleolar stress, autophagy dysregulation, and stress granule formation [@pmid:42003432]. | 2001 [@pmid:11486088] | Intron 1 | - | [
"CAGG"
] | [
"CAGG"
] | [] | [
"ACAG"
] | [] | [
"CCTG"
] | [] | [
"CTGT"
] | [] | [
{
"motif": "CAGG",
"count": null,
"type": "pathogenic_repeat"
},
{
"motif": "CAGA",
"count": 10,
"type": "flank_repeat"
},
{
"motif": "CA",
"count": 19,
"type": "flank_repeat"
}
] | 11 | 26 | 27 | 74 | 75 | 11,000 | 4 | 20.8 | ref | [
"9728"
] | [
"NBK1466"
] | [
"MYT020"
] | [
"419137"
] | [
"0011266"
] | [
"602668"
] | [
"606"
] | [
"CNBP"
] | [
"CNBP"
] | [
"TR35563",
"TR35564",
"TR35565"
] | [
"741073"
] | [] | [
"somatic_instability",
"motif_affects_instability"
] | [
"myotonic_dystrophy"
] | [
"pmid:29086017",
"pmid:31159885",
"pmid:22140091",
"pmid:38467784",
"pmid:42003432",
"genereviews:NBK1466",
"pmid:35245110",
"pmid:39703464",
"pmid:35483324",
"pmid:11486088",
"mondo:0011266"
] | [
"pmid:42094143",
"pmid:41937177",
"pmid:41610137",
"pmid:41074692",
"pmid:40113266",
"pmid:39894140",
"pmid:39240646",
"pmid:39119544",
"pmid:38922834",
"pmid:37950892",
"pmid:37461657",
"pmid:37146135",
"pmid:36778282",
"pmid:36018009",
"pmid:35945246",
"pmid:35567413",
"pmid:341014... |
EDM1-PSACH_COMP | EDM1, PSACH | COMP | [
"Definitive"
] | chr19 | 18,786,034 | 18,786,050 | 18,896,844 | 18,896,860 | 18,921,630 | 18,921,645 | Multiple epiphyseal dysplasia, Pseudoachondroplasia | [
"AD"
] | [
"Mendelian"
] | Pseudoachondroplasia is characterized by severe growth deficiency and deformations such as bow legs and hyperlordosis. Multiple epiphyseal dysplasia type 1 (MED 1) is a form of multiple epiphyseal dysplasia that is characterized by normal or mild short stature, pain in the hips and/or knees, progressive deformity of ex... | [
"HP:0000763 Sensory neuropathy",
"HP:0000926 Platyspondyly",
"HP:0001156 Brachydactyly",
"HP:0001249 Intellectual disability",
"HP:0001288 Gait disturbance",
"HP:0001376 Limitation of joint mobility",
"HP:0001377 Limited elbow extension",
"HP:0001382 Joint hypermobility",
"HP:0001385 Hip dysplasia",... | null | Specific contribution of COMP repeats to EDM1 is unknown (~300 COMP mutation variants for both phenotypes); likely 1:90,000 prevalence for COMP-PSACH that is repeat-specific. Found across ancestries/ethnicities [@genereviews:NBK1123; @genereviews:NBK1487]. | Typical: 0-2 (COMP-PSACH)/ 1-12 (EDM1); Range: 0 (PSACH) - 13 (EDM1). 3-13 specific to trinucleotide expansions (duplications) [@pmid:29530484], several contractions but unknown exact AoO [@genereviews:NBK1123; @genereviews:NBK1487]. | 3 | 13 | null | null | Both expansions to (GTC)6-7 and contractions to (GTC)4 are associated with disease [@genereviews:NBK1487]. | null | LoF/GoF? | Poly-aspartic acid expansions, domain dependent [@pmid:29530484]; may involve misfolding but still unestablished [@genereviews:NBK1123]. | 1999 [@pmid:9887340] | Coding Exon 13 | - | [
"GTC"
] | [
"CGT"
] | [] | [] | [] | [
"ACG"
] | [] | [] | [] | [] | 5 | 5 | null | null | 6 | 7 | 3 | 5 | ref | [
"4540",
"2180"
] | [
"NBK1123",
"NBK1487"
] | [
"EPP017",
"PSD012"
] | [
"98378",
"325376"
] | [
"0008322",
"0007561"
] | [
"132400",
"177170"
] | [
"750",
"93308"
] | [
"COMP"
] | [
"COMP"
] | [
"TR155017"
] | [
"1317658"
] | [
"STR_673389"
] | [
"contraction"
] | [
"phenotypic_spectrum"
] | [
"pmid:29530484",
"genereviews:NBK1123",
"genereviews:NBK1487",
"pmid:9887340",
"mondo:0008322",
"mondo:0007561"
] | [
"pmid:32097846",
"pmid:28924040",
"pmid:21644213",
"pmid:18353302",
"pmid:15014436",
"pmid:12483437"
] |
EPM_CSNK1E | EPM, DEE | CSNK1E | [
"Limited"
] | chr22 | 38,317,282 | 38,317,375 | 38,713,287 | 38,713,380 | 38,781,587 | 38,781,680 | Progressive Myoclonic Epilepsy and Developmental and Epileptic Encephalopathy | [
"AD"
] | [
"Mendelian"
] | Progressive myoclonic epilepsy is a heterogeneous neurodegenerative disorder characterized by early-onset myoclonus, epilepsy, generalized tonic-clonic seizures, and progressive neurological deterioration [@pmid:40751262]. It has also been proposed that this locus is associated with developmental and epileptic encephal... | [
"HP:0000726 Dementia",
"HP:0000992 Cutaneous Photosensitivity",
"HP:0001249 Intellectual Disability",
"HP:0001251 Ataxia",
"HP:0001260 Dysarthia",
"HP:0001336 Myoclonous",
"HP:0002070 Limb Ataxia",
"HP:0002080 Intention Tremor",
"HP:0002392 EEG with Polyspike Wave Complexes",
"HP:0007000 Morning M... | null | EPM found in one Azerbaijani proband [@pmid:40751262] and DEE found in two additional patients [@pmid:39107278]. This expansion has been reported in unaffected individuals [@pmid:40751262]. | EPM case reports age of onset 10 years [@pmid:40751262] and DEE cases onset in infancy. | 0 | 10 | null | null | CGG repeat in exon 1 of CSNK1E. Longest reported expanded allele of an affected individual is 745, with an unaffected sibling with repeat length 980. Father had a repeat of 8 and mother of 131. | Exome sequencing does not reliably detect expansions at this locus. Reported cases were identified through methylation outlier detection and confirmed by targeted long-read sequencing [@pmid:40751262]. | Unknown | Mechanism of this disease is largely unknown, but hypermethylation is observed. Expanded alleles exhibit hypermethylation and may mediate epigenetic silencing. Unaffected carriers have been observed, indicating variable expressivity or penetrance. | 2025 | Exon 1 | - | [
"CCG"
] | [
"CCG"
] | [] | [] | [] | [
"CGG"
] | [] | [] | [] | [
{
"motif": "CCG",
"count": null,
"type": "pathogenic_repeat"
}
] | 0 | 48 | 49 | 131 | 745 | 980 | 3 | null | null | [
"7140"
] | [] | [
"MYC080"
] | [
"199732"
] | [
"0020074"
] | [
"600863"
] | [] | [
"CSNK1E"
] | [] | [
"TR344466"
] | [] | [] | [] | [
"epilepsy"
] | [
"pmid:40751262",
"pmid:39107278"
] | [] |
EPM1_CSTB | EPM1 | CSTB | [
"Definitive"
] | chr21 | 43,776,442 | 43,776,479 | 45,196,323 | 45,196,360 | 42,132,054 | 42,132,091 | Progressive Myoclonic Epilepsy Type 1 (EPM1), a.k.a. Unverricht-Lundborg Disease (ULD) | [
"AR"
] | [
"Mendelian"
] | Unverricht-Lundborg disease (ULD) is a rare progressive myoclonic epilepsy disorder characterized by action- and stimulus-sensitive myoclonus, and tonic-clonic seizures with ataxia, but with only a mild cognitive decline over time [@mondo:0009698]. | [
"HP:0000726 Dementia",
"HP:0000992 Cutaneous photosensitivity",
"HP:0001249 Intellectual disability",
"HP:0001251 Ataxia",
"HP:0001256 Mild intellectual disability",
"HP:0001260 Dysarthria",
"HP:0001268 Mental deterioration",
"HP:0001336 Myoclonus",
"HP:0002069 Bilateral tonic-clonic seizure",
"HP... | null | Worldwide prevalence unknown; Finland prevalence 2-4/100,000. Found across ethnicities/ancestries, with population-dependent prevalence; highest in Tunisia, Algeria, Morocco, and Finland [@genereviews:NBK1142]. | Typical: 6-15 [@genereviews:NBK1142]; Range: 6-18 [@pmid:18325013]. | 6 | 18 | 6 | 15 | Affected individuals have an unstable 12-nucleotide (dodecamer) repeat expansion. Alleles containing 2-3 motifs are considered benign, while alleles with 30-125 repeats are fully penetrant [@pmid:18325013]. Alleles in the range 12-17 repeats have been observed, however the individuals carrying them have not undergone c... | Short-read sequencing cannot detect pathogenic expansions. Conventional PCR has detected normal range alleles, while Southern blotting approximates expanded allele size [@genereviews:NBK1142]. | LoF | The repeat expansion causes significantly reduced expression of cystatin-B protein [@genereviews:NBK1142]. | 1997 [@pmid:9126745] | 5' UTR | - | [
"CGCGGGGCGGGG"
] | [
"CGCGGGGCGGGG"
] | [] | [] | [] | [
"CCCCGCCCCGCG"
] | [] | [] | [] | [] | 2 | 3 | null | null | 30 | 125 | 12 | null | null | [
"3876"
] | [
"NBK1142"
] | [
"MYC080"
] | [
"155923"
] | [
"0009698"
] | [
"254800"
] | [
"308"
] | [
"CSTB"
] | [] | [
"TR163552"
] | [
"5547429"
] | [
"STR_886261"
] | [
"length_affects_onset",
"length_affects_severity"
] | [
"ataxia"
] | [
"genereviews:NBK1142",
"pmid:18325013",
"pmid:9126745",
"mondo:0009698"
] | [
"pmid:42094143",
"pmid:41268177",
"pmid:41074692",
"pmid:40442775",
"pmid:40340521",
"pmid:39156922",
"pmid:38135787",
"pmid:36398398",
"pmid:36359887",
"pmid:34474241",
"pmid:32920378",
"pmid:32875576",
"pmid:29352102",
"pmid:25752200",
"pmid:23883076",
"pmid:22581592",
"pmid:217578... |
SCA37_DAB1 | SCA37 | DAB1 | [
"Strong"
] | chr1 | 57,367,043 | 57,367,121 | 57,832,715 | 57,832,793 | 57,245,935 | 57,245,973 | Spinocerebellar ataxia type 37 | [
"AD"
] | [
"Mendelian"
] | Spinocerebellar ataxia type 37 (SCA37) is a subtype of autosomal dominant cerebellar ataxia type 1 (ADCA type 1), characterized by a cerebellar syndrome along with altered vertical eye movements [@mondo:0014410]. | [
"HP:0000407 Sensorineural hearing impairment",
"HP:0000549 Abnormal conjugate eye movement",
"HP:0000639 Nystagmus",
"HP:0000666 Horizontal nystagmus",
"HP:0001251 Ataxia",
"HP:0001260 Dysarthria",
"HP:0001272 Cerebellar atrophy",
"HP:0001288 Gait disturbance",
"HP:0001336 Myoclonus",
"HP:0001337 ... | null | 0.20/100,000 specific to Portugal; not yet found in other geographic regions. Founder effect from Iberian Peninsula [@genereviews:NBK541729]. | Typical: 33-53; Range: 18-64 [@genereviews:NBK541729]. | 18 | 64 | 33 | 53 | Pathogenicity only associated with pathogenic motif >30 repeats, flanked by at least 58 repeats of reference motif on either side; reference repeat (AAAAT) can range from 1 to 400 repeats, although typically less than 30 [@genereviews:NBK541729]. The pathogenic motif is unstable, particularly when transmitted by the fa... | Short-read sequencing, exome sequencing, and RP-PCR do not accurately detect this repeat, but long-range PCR with targeted Sanger sequencing is commonly used for detection and characterization [@genereviews:NBK541729]. | GoF | Toxic gain-of-function mechanism in protein, associated with alternative splicing, an RNA switch, and an upregulation of reelin-DAB1 signalling [@omim:615945; @pmid:30284037]. | 2017 [@pmid:28686858] | Intron 1 (most isoforms) | - | [
"AAAAT"
] | [
"TGAAA"
] | [] | [
"AAAAA"
] | [] | [
"TTTCA"
] | [] | [
"TTTTT"
] | [] | [
{
"motif": "AAAAT",
"count": 7,
"type": "internal_repeat"
},
{
"motif": "GAAAT",
"count": null,
"type": "pathogenic_repeat"
}
] | 0 | 30 | null | null | 31 | 75 | 5 | 0 | novel | [
"12368"
] | [
"NBK541729"
] | [
"SPN283"
] | [
"855217"
] | [
"0014410"
] | [
"615945"
] | [
"363710"
] | [
"DAB1"
] | [
"DAB1"
] | [
"TR3445"
] | [
"1144531"
] | [
"STR_39393"
] | [
"maternal_expansion",
"paternal_expansion",
"motif_affects_onset",
"motif_affects_penetrance"
] | [
"spinocerebellar_ataxia"
] | [
"genereviews:NBK541729",
"omim:615945",
"pmid:30284037",
"pmid:28686858",
"mondo:0014410"
] | [
"pmid:41871099",
"pmid:41426430",
"pmid:38961870",
"pmid:36622139",
"pmid:36148898",
"pmid:36092952",
"pmid:32582864",
"pmid:30588707"
] |
FRA12A_DIP2B | FRA12A | DIP2B | [
"Disputed"
] | chr12 | 50,505,001 | 50,505,024 | 50,898,784 | 50,898,807 | 50,468,095 | 50,468,118 | Intellectual developmental disorder, FRA12A type | [
"AD"
] | [
"Mendelian"
] | FRA12A is a rare, folate-sensitive chromosomal fragile site on chromosome 12 associated with intellectual developmental disorder, FRA12A type. Impaired intellectual development with or without other anomalies has been described in patients with over 40% of cells expressing FRA12A [@omim:136630]. The DIP2B CGG repeat ex... | [
"HP:0000708 Atypical behavior",
"HP:0000962 Hyperkeratosis",
"HP:0001019 Erythroderma",
"HP:0001249 Intellectual disability",
"HP:0001250 Seizure",
"HP:0001263 Global developmental delay",
"HP:0002783 Recurrent lower respiratory tract infections"
] | null | Appears to occur in those of European ancestry/ethnicity [@omim:136630]. | Typical: 0-1 (small sample size) [@pmid:3742859]. Range: 0-3 [@pmid:4042396]. | 0 | 3 | null | null | Repeat ranges reflect affected and unaffected individuals from a cohort study of 70 controls (6-23 repeats), unaffected carriers representing the intermediate alleles (139-206), and affected individuals (273-306) [@pmid:17236128]. It has been hypothesized that unmethylated expansions may correspond to movement-related ... | Short-read sequencing can underestimate expansion size. RP-PCR and Southern blotting detect expansions [@pmid:17236128], while long-read sequencing has been reported to accurately size them [@pmid:39854091]. | LoF | Hypermethylation leading to decreased expression, although unmethylated expansion leads to increased expression [@omim:136630; @pmid:37248219]. | 2007 [@pmid:17236128] | 5' UTR | + | [
"CGG"
] | [
"CGG"
] | [] | [] | [] | [
"CGG"
] | [] | [] | [] | [] | 6 | 23 | 139 | 206 | 273 | 306 | 3 | 7 | ref | [] | [
"NBK535148"
] | [
"INT482"
] | [
"369613"
] | [
"0007634"
] | [
"136630"
] | [] | [
"DIP2B"
] | [
"DIP2B"
] | [
"TR116656"
] | [
"5075695"
] | [
"Expansion_FRA12A_MR/DIP2B"
] | [] | [] | [
"pmid:3742859",
"pmid:4042396",
"omim:136630",
"pmid:37248219",
"pmid:17236128",
"pmid:39854091",
"pmid:34622207",
"pmid:38418263",
"pmid:42205056",
"url:https://strchive.org/critria/FRA12A_DIP2B"
] | [
"pmid:37090938"
] |
DMD_DMD | DMD | DMD | [
"Refuted"
] | chrX | 31,284,557 | 31,284,605 | 31,302,674 | 31,302,722 | 30,882,677 | 30,882,743 | Duchenne muscular dystrophy | [
"XR"
] | [
"Mendelian"
] | Duchenne muscular dystrophy (DMD) is a neuromuscular disease characterized by rapidly progressive muscle weakness and wasting due to degeneration of skeletal, smooth and cardiac muscle [@mondo:0010679]. | [
"HP:0000750 Delayed speech and language development",
"HP:0001252 Hypotonia",
"HP:0001256 Mild intellectual disability",
"HP:0001263 Global developmental delay",
"HP:0001265 Hyporeflexia",
"HP:0001270 Motor delay",
"HP:0001324 Muscle weakness",
"HP:0001328 Specific learning disability",
"HP:0001371 ... | 4.8/100000 | Believed to be 0 for disease specific to STR expansion. 1/3500-4700 male births (incidence) for overall DMD (one of the most common and severe congenital myopathies) [@genereviews:NBK1119]. 4.8/100,000 prevalence [@pmid:35168641]. DMD repeat locus expansion only identified in one Greek family [@pmid:27417533]. | Typical: 6-7 (usual disease is 0-3) [@pmid:27417533]. | 6 | 7 | null | null | There is conflicting evidence for the association between this repeat expansion and Duchenne muscular dystrophy. The association was reported in a single family, from which the benign and pathogenic ranges were inferred from affected and unaffected family members [@pmid:27417533]. The population frequency of the propos... | null | LoF | Functional defect in dystrophin/dystroglycan [@pmid:16969582]. | 2016 [@pmid:27417533] | Intron 62 | - | [
"TTC"
] | [
"CTT"
] | [] | [] | [] | [
"AAG"
] | [] | [] | [] | [
{
"motif": "TTC",
"count": null,
"type": "pathogenic_repeat"
},
{
"motif": "T",
"count": 8,
"type": "flank_repeat"
}
] | 16 | 33 | null | null | 59 | 82 | 3 | 16.7 | ref | [
"6291"
] | [
"NBK535148"
] | [
"MSC157"
] | [
"3925"
] | [
"0010679"
] | [
"310200"
] | [
"98896"
] | [
"DMD"
] | [
"DMD"
] | [
"TR167703"
] | [] | [
"STR_1545664"
] | [] | [] | [
"pmid:27417533",
"pmid:16969582",
"genereviews:NBK1119",
"pmid:35168641",
"mondo:0010679",
"pmid:40140942",
"url:https://strchive.org/critria/DMD_DMD"
] | [
"pmid:41906116",
"pmid:41691287",
"pmid:41244984",
"pmid:41173008",
"pmid:39874107",
"pmid:39803454",
"pmid:39713478",
"pmid:39251998",
"pmid:38290145",
"pmid:37829280",
"pmid:37270548",
"pmid:37090938",
"pmid:36975100",
"pmid:36048237",
"pmid:35615378",
"pmid:35093299",
"pmid:343711... |
DM1_DMPK | DM1 | DMPK | [
"Definitive"
] | chr19 | 45,770,204 | 45,770,266 | 46,273,462 | 46,273,524 | 48,597,739 | 48,597,756 | Myotonic dystrophy type 1 | [
"AD"
] | [
"Mendelian"
] | Steinert disease, also known as myotonic dystrophy type 1, is a muscle disease characterized by myotonia and by multiorgan damage that combines various degrees of muscle weakness, arrhythmia and/or cardiac conduction disorders, cataract, endocrine damage, sleep disorders and baldness [@mondo:0008056]. It has also been ... | [
"HP:0000026 Male hypogonadism",
"HP:0000029 Testicular atrophy",
"HP:0000135 Hypogonadism",
"HP:0000144 Decreased fertility",
"HP:0000467 Neck muscle weakness",
"HP:0000483 Astigmatism",
"HP:0000518 Cataract",
"HP:0000540 Hypermetropia",
"HP:0000602 Ophthalmoplegia",
"HP:0000708 Atypical behavior"... | 9.27/100000 | 5-20/100,000 [@genereviews:NBK1165]. 0.5-18.1/100,000 [@pmid:29100084]; 6.5/100,000 [@pmid:31159885]. 9.27 cases (95% CI: 4.73-15.21) per 100,000, ranging from 0.37 to 36.29 cases per 100,000 [@pmid:35483324]. Found across ethnicities/ancestries, with population-dependent prevalence [@genereviews:NBK1165]. | Typical: 10-30 [@genereviews:NBK1165]; Range: 0-74 [@pmid:38454488]. | 0 | 74 | 10 | 30 | Intermediate alleles of 35-49 repeats are associated with premutation [@genereviews:NBK1165]. An estimated 3%-11% of DM1 expansions contain interruptions of CCG, CTC, CGG, GGC or CAG motifs [@pmid:27991661; @pmid:32851192]; GCGGCA has also been reported [@pmid:39710066]. In addition, an altered pattern of muscle involv... | Flanking PCR has detected alleles up to ~150 repeats, while RP-PCR may detect missed expanded alleles [@genereviews:NBK1165; @pmid:24795756]. Southern blotting has approximated the size of large expansions [@pmid:22643181], while long-read sequencing has resolved repeat size and structure [@pmid:41974889]. | GoF | RNA gain-of-function: RNA gelation leading to misregulation of alternative splicing [@pmid:36169768]. Expanded DMPK r(CUG)n RNA forms a hairpin containing periodic 1*1 U/U internal loops that engage/sequester MBNL family RNA-binding proteins, especially MBNL1 [@pmid:42182465], disrupting pre mRNA processing and contrib... | 1992 [@pmid:1310900] | 3' UTR | - | [
"CAG"
] | [
"CAG"
] | [] | [] | [] | [
"CTG"
] | [] | [] | [] | [] | 5 | 34 | 35 | 49 | 50 | 4,000 | 3 | 20.7 | ref | [
"8310"
] | [
"NBK1165"
] | [
"MYT021"
] | [
"886881"
] | [
"0008056"
] | [
"160900"
] | [
"273"
] | [
"DMPK"
] | [
"DMPK"
] | [
"TR156684"
] | [
"5650727"
] | [
"Expansion_DM1/DMPK"
] | [
"somatic_instability",
"anticipation",
"maternal_expansion",
"length_affects_onset",
"length_affects_phenotype",
"length_affects_severity",
"motif_affects_instability",
"motif_affects_onset",
"motif_affects_phenotype",
"motif_affects_severity",
"proposed_modifier"
] | [
"myotonic_dystrophy"
] | [
"genereviews:NBK1165",
"pmid:38454488",
"pmid:36169768",
"pmid:42182465",
"pmid:39932794",
"pmid:40259070",
"pmid:41929128",
"pmid:42227335",
"pmid:42261605",
"pmid:32851192",
"pmid:39710066",
"pmid:35741732",
"pmid:39679849",
"pmid:29100084",
"pmid:31159885",
"pmid:35483324",
"pmid:... | [
"pmid:42486096",
"pmid:42450630",
"pmid:42427665",
"pmid:42419013",
"pmid:42273033",
"pmid:42196324",
"pmid:42133999",
"pmid:41974889",
"pmid:41951733",
"pmid:41946260",
"pmid:41855125",
"pmid:41848171",
"pmid:41766784",
"pmid:41762523",
"pmid:41722569",
"pmid:41710065",
"pmid:417071... |
End of preview.
No dataset card yet
- Downloads last month
- 29