Instructions to use multimolecule/mmsplice with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/mmsplice with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/mmsplice") model = AutoModel.from_pretrained("multimolecule/mmsplice") inputs = tokenizer("UAGCUUAUCAGACUGAUGUUGA", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_state - Notebooks
- Google Colab
- Kaggle
File size: 2,856 Bytes
2f31775 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 | {
"acceptor_exon_length": 3,
"acceptor_intron_cut": 6,
"acceptor_intron_length": 50,
"architectures": [
"MmSpliceForSequencePrediction"
],
"bos_token_id": null,
"donor_exon_length": 5,
"donor_intron_cut": 6,
"donor_intron_length": 13,
"dtype": "float32",
"eos_token_id": null,
"head": {
"act": null,
"bias": true,
"dropout": 0.0,
"hidden_size": 1,
"layer_norm_eps": 1e-12,
"loss_weight": null,
"num_labels": 1,
"output_name": null,
"problem_type": "regression",
"transform": null,
"transform_act": "gelu",
"type": null
},
"hidden_size": 5,
"id2label": null,
"label2id": null,
"mask_token_id": 4,
"model_type": "mmsplice",
"modules_config": {
"acceptor": {
"architecture": "dense",
"batch_norm_eps": 0.001,
"conv_activation": "relu",
"conv_batch_norm": true,
"conv_channels": 32,
"conv_kernel_size": 15,
"dropout": 0.2,
"flatten_dropout": true,
"hidden_sizes": [],
"pointwise_channels": 32,
"pool_mask_zeros": false,
"region_length": 53
},
"acceptor_intron": {
"architecture": "conv",
"batch_norm_eps": 0.001,
"conv_activation": "relu",
"conv_batch_norm": false,
"conv_channels": 256,
"conv_kernel_size": 13,
"dropout": 0.2,
"flatten_dropout": false,
"hidden_sizes": [],
"pointwise_channels": 0,
"pool_mask_zeros": false,
"region_length": 0
},
"donor": {
"architecture": "dense",
"batch_norm_eps": 0.001,
"conv_activation": "linear",
"conv_batch_norm": false,
"conv_channels": 0,
"conv_kernel_size": 0,
"dropout": 0.2,
"flatten_dropout": false,
"hidden_sizes": [
128,
64
],
"pointwise_channels": 0,
"pool_mask_zeros": false,
"region_length": 18
},
"donor_intron": {
"architecture": "conv",
"batch_norm_eps": 0.001,
"conv_activation": "relu",
"conv_batch_norm": false,
"conv_channels": 256,
"conv_kernel_size": 13,
"dropout": 0.2,
"flatten_dropout": false,
"hidden_sizes": [],
"pointwise_channels": 0,
"pool_mask_zeros": false,
"region_length": 0
},
"exon": {
"architecture": "conv",
"batch_norm_eps": 0.001,
"conv_activation": "relu",
"conv_batch_norm": true,
"conv_channels": 128,
"conv_kernel_size": 11,
"dropout": 0.2,
"flatten_dropout": false,
"hidden_sizes": [],
"pointwise_channels": 0,
"pool_mask_zeros": true,
"region_length": 0
}
},
"null_token_id": 5,
"num_labels": 1,
"pad_token_id": 4,
"problem_type": "regression",
"tie_word_embeddings": true,
"transformers_version": "5.9.0",
"unk_token_id": 3,
"vocab_size": 4
}
|