Instructions to use multimolecule/bpfold with libraries, inference providers, notebooks, and local apps. Follow these links to get started.
- Libraries
- MultiMolecule
How to use multimolecule/bpfold with MultiMolecule:
pip install multimolecule
from multimolecule import AutoModel, AutoTokenizer tokenizer = AutoTokenizer.from_pretrained("multimolecule/bpfold") model = AutoModel.from_pretrained("multimolecule/bpfold") inputs = tokenizer("UAGCUUAUCAGACUGAUGUUGA", return_tensors="pt") outputs = model(**inputs) embeddings = outputs.last_hidden_stateimport multimolecule from transformers import pipeline predictor = pipeline("rna-secondary-structure", model="multimolecule/bpfold") output = predictor("UAGCUUAUCAGACUGAUGUUGA") print(output["secondary_structure"]) - Notebooks
- Google Colab
- Kaggle
File size: 1,103 Bytes
b0e7194 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 | {
"architectures": [
"BpfoldModel"
],
"attention_head_size": 32,
"bos_token_id": 1,
"dtype": "float32",
"eos_token_id": 2,
"hidden_dropout": 0.1,
"hidden_size": 256,
"id2label": null,
"intermediate_size": 768,
"label2id": null,
"mask_token_id": 4,
"max_length": 600,
"model_type": "bpfold",
"motif_radius": 3,
"null_token_id": 5,
"num_hidden_layers": 12,
"num_labels": 1,
"num_members": 6,
"num_pairwise_convolutions": 3,
"pad_token_id": 0,
"pairwise_kernel_size": 3,
"pos_weight": 300.0,
"positional_embedding": "dyn",
"postprocess_iterations": 100,
"postprocess_lr_max": 0.1,
"postprocess_lr_min": 0.01,
"postprocess_nc_rho": 0.5,
"postprocess_nc_s": 0.5,
"postprocess_rho": 1.6,
"postprocess_s": 1.5,
"postprocess_with_l1": true,
"separate_outer_inner_energy": true,
"threshold": 0.5,
"tie_word_embeddings": true,
"transformers_version": "5.9.0",
"unk_token_id": 3,
"use_base_pair_energy": true,
"use_base_pair_probability": false,
"use_postprocessing": false,
"use_squeeze_excitation": true,
"vocab_size": 11
}
|