--- datasets: - multimolecule/rnacentral - multimolecule/rfam - multimolecule/ensembl-genome-browser - multimolecule/nucleotide language: rna library_name: multimolecule license: agpl-3.0 mask_token: pipeline_tag: fill-mask tags: - Biology - RNA - ncRNA widget: - example_title: microRNA 21 mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: U score: 0.182346 - label: A score: 0.163327 - label: G score: 0.162945 - label: X score: 0.161102 - label: C score: 0.138805 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: UAGCUUAUCAGCUGAUGUUGA - example_title: microRNA 146a mask_index: 10 mask_index_1based: 11 masked_char: A output: - label: A score: 0.174767 - label: U score: 0.173765 - label: G score: 0.160257 - label: X score: 0.158629 - label: C score: 0.130105 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: UGAGAACUGAUUCCAUGGGUU - example_title: microRNA 155 mask_index: 15 mask_index_1based: 16 masked_char: A output: - label: U score: 0.177485 - label: G score: 0.169577 - label: A score: 0.168204 - label: X score: 0.160879 - label: C score: 0.132323 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: UUAAUGCUAAUCGUGUAGGGGUU - example_title: RNA component of mitochondrial RNA processing endoribonuclease mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: C score: 0.226097 - label: G score: 0.184231 - label: X score: 0.160851 - label: A score: 0.138966 - label: U score: 0.115647 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: GGUUCGUGCUGAGGCCUGUAUCCUAGGCUACACACUGAGGACUCUGUUCCUCCCCUUUCCGCCUAGGGGAAAGUCCCCGGACCUCGGGCAGAGAGUGCCACGUGCAUACGCACGUAGACAUUCCCCGCUUCCCACUCCAAAGUCCGCCAAGAAGCGUAUCCCGCUGAGCGGCGUGGCGCGGGGGCGUCAUCCGUCAGCUCCCUCUAGUUACGCAGGCAGUGCGUGUCCGCGCACCAACCACACGGGGCUCAUUCUCAGCGCGGCUGUAAAAAAAAA - example_title: 7SK small nuclear RNA mask_index: 13 mask_index_1based: 14 masked_char: A output: - label: A score: 0.968171 - label: X score: 0.006591 - label: score: 0.005137 - label: '*' score: 0.004361 - label: . score: 0.004294 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: GGAUGUGAGGGCGUCUGGCUGCGACAUCUGUCACCCCAUUGAUCGCCAGGGUUGAUUCGGCUGAUCUGGCUGGCUAGGCGGGUGUCCCCUUCCUCCCUCACCGCUCCAUGUGCGUCCCUCCCGAAGCUGCGCGCUCGGUCGAAGAGGACGACCAUCCCCGAUAGAGGAGGACCGGUCUUCGGUCAAGGGUAUACGAGUAGCUGCGCUCCCCUGCUAGAACCUCCAAACAAGCUCUCAAGGUCCAUUUGUAGGAGAACGUAGGGUAGUCAAGCUUCCAAGACUCCAGACACAUCCAAAUGAGGCGCUGCAUGUGGCAGUCUGCCUUUCUUUU - example_title: telomerase RNA component mask_index: 23 mask_index_1based: 24 masked_char: A output: - label: U score: 0.191585 - label: X score: 0.154069 - label: C score: 0.152917 - label: A score: 0.144616 - label: G score: 0.132991 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: GGGUUGCGGAGGGUGGGCCUGGGGGGGUGGUGGCCAUUUUUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCCGCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUGCCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGCCCGUUCGCCCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAACCCCGCCUGGAGGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGCCACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGGCGAGGUUCAGGCCUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCCGCGCGCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACACAUGC - example_title: vault RNA 2-1 mask_index: 12 mask_index_1based: 13 masked_char: A output: - label: G score: 0.296311 - label: A score: 0.21848 - label: X score: 0.153834 - label: U score: 0.145476 - label: C score: 0.059464 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: CGGGUCGGAGUUGCUCAAGCGGUUACCUCCUCAUGCCGGACUUUCUAUCUGUCCAUCUCUGUGCUGGGGUUCGAGACCCGCGGGUGCUUACUGACCCUUUUAUGCAA - example_title: brain cytoplasmic RNA 1 mask_index: 18 mask_index_1based: 19 masked_char: A output: - label: A score: 0.927616 - label: X score: 0.02096 - label: G score: 0.009731 - label: '|' score: 0.007956 - label: '*' score: 0.007946 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: GGCCGGGCGCGGUGGCUCCGCCUGUAAUCCCAGCUCUCAGGGAGGCUAAGAGGCGGGAGGAUAGCUUGAGCCCAGGAGUUCGAGACCUGCCUGGGCAAUAUAGCGAGACCCCGUUCUCCAGAAAAAGGAAAAAAAAAAACAAAAGACAAAAAAAAAAUAAGCGUAACUUCCCUCAAAGCAACAACCCCCCCCCCCCUUU - example_title: HIV-1 TAR-WT mask_index: 13 mask_index_1based: 14 masked_char: A output: - label: G score: 0.268135 - label: U score: 0.204114 - label: A score: 0.200433 - label: X score: 0.136009 - label: '*' score: 0.048898 pipeline_tag: fill-mask sequence_type: ncRNA task: fill-mask text: GGUCUCUCUGGUUGACCAGAUCUGAGCCUGGGAGCUCUCUGGCUAACUAGGGAACC - example_title: prion protein (Kanno blood group) mask_index: 21 mask_index_1based: 22 masked_char: A output: - label: C score: 0.249875 - label: G score: 0.203934 - label: X score: 0.159091 - label: U score: 0.14821 - label: A score: 0.084818 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGGCGAACCUUGGCUGCUGGUGCUGGUUCUCUUUGUGGCCACAUGGAGUGACCUGGGCCUCUGC - example_title: interleukin 10 mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: A score: 0.305148 - label: U score: 0.292251 - label: X score: 0.117275 - label: '*' score: 0.065927 - label: G score: 0.057991 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGCACAGCUCGCACUGCUCUGUUGCCUGGUCCUCCUGACUGGGGUGAGGGCC - example_title: Zaire ebolavirus mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: U score: 0.294927 - label: A score: 0.286149 - label: X score: 0.127361 - label: C score: 0.094125 - label: '*' score: 0.053796 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AAUGUUCAAACCUUUGUGAAGCUCUGUUAGCUGAUGGUCUUGCUAAAGCAUUUCCUAGCAAUAUGAUGGUAGUCACAGAGCGUGAGCAAAAAGAAAGCUUAUUGCAUCAAGCAUCAUGGCACCACACAAGUGAUGAUUUUGGUGAGCAUGCCACAGUUAGAGGGAGUAGCUUUGUAACUGAUUUAGAGAAAUACAAUCUUGCAUUUAGAUAUGAGUUUACAGCACCUUUUAUAGAAUAUUGUAACCGUUGCUAUGGUGUUAAGAAUGUUUUUAAUUGGAUGCAUUAUACAAUCCCACAGUGUUAU - example_title: SARS coronavirus mask_index: 14 mask_index_1based: 15 masked_char: A output: - label: U score: 0.303839 - label: X score: 0.156264 - label: C score: 0.141866 - label: A score: 0.141266 - label: G score: 0.09792 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGUUUAUUUUCUUUUAUUUCUUACUCUCACUAGUGGUAGUGACCUUGACCGGUGCACCACUUUUGAUGAUGUUCAAGCUCCUAAUUACACUCAACAUACUUCAUCUAUGAGGGGGGUUUACUAUCCUGAUGAAAUUUUUAGAUCAGACACUCUUUAUUUAACUCAGGAUUUAUUUCUUCCAUUUUAUUCUAAUGUUACAGGGUUUCAUACUAUUAAUCAUACGUUUGACAACCCUGUCAUACCUUUUAAGGAUGGUAUUUAUUUUGCUGCCACAGAGAAAUCAAAUGUUGUCCGUGGUUGGGUUUUUGGUUCUACCAUGAACAACAAGUCACAGUCGGUGAUUAUUAUUAACAAUUCUACUAAUGUUGUUAUACGAGCAUGUAACUUUGAAUUGUGUGACAACCCUUUCUUUGCUGUUUCUAAACCCAUGGGUACACAGACACAUACUAUGAUAUUCGAUAAUGCAUUUAAAUGCACUUUCGAGUACAUAUCU - example_title: insulin mask_index: 12 mask_index_1based: 13 masked_char: A output: - label: C score: 0.596569 - label: G score: 0.135795 - label: X score: 0.094183 - label: A score: 0.04663 - label: '*' score: 0.041054 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGGCCCUGUGGUGCGCCUCCUGCCCCUGCUGGCGCUGCUGGCCCUCUGGGGACCUGACCCAGCCGCAGCCUUUGUGAACCAACACCUGUGCGGCUCACACCUGGUGGAAGCUCUCUACCUAGUGUGCGGGGAACGAGGCUUCUUCUACACACCCAAGACCCGCCGGGAGGCAGAGGACCUGCAGGUGGGGCAGGUGGAGCUGGGCGGGGGCCCUGGUGCAGGCAGCCUGCAGCCCUUGGCCCUGGAGGGGUCCCUGCAGAAGCGUGGCAUUGUGGAACAAUGCUGUACCAGCAUCUGCUCCCUCUACCAGCUGGAGAACUACUGCAACUAG - example_title: cyclin dependent kinase inhibitor 2A mask_index: 18 mask_index_1based: 19 masked_char: A output: - label: G score: 0.278792 - label: A score: 0.206863 - label: C score: 0.14254 - label: X score: 0.138775 - label: '*' score: 0.070909 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGGAGCCGGCGGCGGGGGCAGCAUGGAGCCUUCGGCUGACUGGCUGGCCACGGCCGCGGCCCGGGGUCGGGUAGAGGAGGUGCGGGCGCUGCUGGAGGCGGGGGCGCUGCCCAACGCACCGAAUAGUUACGGUCGGAGGCCGAUCCAGGUCAUGAUGAUGGGCAGCGCCCGAGUGGCGGAGCUGCUGCUGCUCCACGGCGCGGAGCCCAACUGCGCCGACCCCGCCACUCUCACCCGACCCGUGCACGACGCUGCCCGGGAGGGCUUCCUGGACACGCUGGUGGUGCUGCACCGGGCCGGGGCGCGGCUGGACGUGCGCGAUGCCUGGGGCCGUCUGCCCGUGGACCUGGCUGAGGAGCUGGGCCAUCGCGAUGUCGCACGGUACCUGCGCGCGGCUGCGGGGGGCACCAGAGGCAGUAACCAUGCCCGCAUAGAUGCCGCGGAAGGUCCCUCAGACAUCCCCGAUUGA - example_title: human papillomavirus type 16 E6 mask_index: 10 mask_index_1based: 11 masked_char: A output: - label: A score: 0.23786 - label: U score: 0.202088 - label: G score: 0.150697 - label: X score: 0.13966 - label: '*' score: 0.090803 pipeline_tag: fill-mask sequence_type: mRNA task: fill-mask text: AUGCACCAAAGAGAACUGCAAUGUUUCAGGACCCACAGGAGCGACCCAGAAAGUUACCACAGUUAUGCACAGAGCUGCAAACAACUAUACAUGAUAUAAUAUUAGAAUGUGUGUACUGCAAGCAACAGUUACUGCGACGUGAGGUAUAUGACUUUGCUUUUCGGGAUUUAUGCAUAGUAUAUAGAGAUGGGAAUCCAUAUGCUGUAUGUGAUAAAUGUUUAAAGUUUUAUUCUAAAAUUAGUGAGUAUAGACAUUAUUGUUAUAGUUUGUAUGGAACAACAUUAGAACAGCAAUACAACAAACCGUUGUGUGAUUUGUUAAUUAGGUGUAUUAACUGUCAAAAGCCACUGUGUCCUGAAGAAAAGCAAAGACAUCUGGACAAAAAGCAAAGAUUCCAUAAUAUAAGGGGUCGGUGGACCGGUCGAUGUAUGUCUUGUUGCAGAUCAUCAAGAACACGUAGAGAAACCCAGCUGUAA - example_title: NRAS proto-oncogene mask_index: 36 mask_index_1based: 37 masked_char: A output: - label: C score: 0.376813 - label: U score: 0.182384 - label: X score: 0.137855 - label: G score: 0.090835 - label: A score: 0.057852 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: GGGGCCGGAAGUGCCGCUCCUUGGUGGGGGCUGUUCUGGCGGUUCCGGGGUCUCCAACAUUUUUCCCGGCUGUGGUCCUAAAUCUGUCCAAAGCAGAGGCAGUGGAGCUUGAGGUUCUUGCUGGUGUGAA - example_title: amyloid beta precursor protein mask_index: 15 mask_index_1based: 16 masked_char: A output: - label: G score: 0.420064 - label: X score: 0.129558 - label: C score: 0.121108 - label: A score: 0.088767 - label: '*' score: 0.063158 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: GUCAGUUUCCUCGGCGCGGUAGGCGAGAGCACGCGGAGGAGCGUGCGCGGGGGCCCCGGGAGACGGCGGCGGUGGCGGCGCGGGCAGAGCAAGGACGCGGCGGAUCCCACUCGCACAGCAGCGCACUCGGUGCCCCGCGCAGGGUCGCG - example_title: RUNX family transcription factor 1 mask_index: 15 mask_index_1based: 16 masked_char: A output: - label: A score: 0.240759 - label: U score: 0.191693 - label: C score: 0.188958 - label: X score: 0.148234 - label: '*' score: 0.062019 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: ACUUCUUUGGGCCUCUAAACAACCACAGAACCACAAGUUGGGUAGCCUGGCAGUGUCAGAAGUCUGAACCCAGCAUAGUGGUCAGCAGGCAGGACGAAUCACACUGAAUGCAAACCACAGGGUUUCGCAGCGUGGUAAAAGAAAUCAUUGAGUCCCCCGCCUUCAGAAGAGGGUGCAUUUUCAGGAGGAAGCG - example_title: fragile X messenger ribonucleoprotein 1 mask_index: 15 mask_index_1based: 16 masked_char: A output: - label: C score: 0.234132 - label: G score: 0.193929 - label: X score: 0.150817 - label: A score: 0.128924 - label: U score: 0.088382 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: CUCAGUCAGGCGCUCGCUCCGUUUCGGUUUCACUUCCGGUGGAGGGCCGCCUCUGAGCGGGCGGCGGGCCGACGGCGAGCGCGGGCGGCGGCGGUGACGGAGGCGCCGCUGCCAGGGGGCGUGCGGCAGCGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGAGGCGGCGGCGGCGGCGGCGGCGGCGGCGGCUGGGCCUCGAGCGCCCGCAGCCCACCUCUCGGGGGCGGGCUCCCGGCGCUAGCAGGGCUGAAGAGAAG - example_title: MYC proto-oncogene mask_index: 10 mask_index_1based: 11 masked_char: A output: - label: U score: 0.203058 - label: G score: 0.192648 - label: X score: 0.152914 - label: C score: 0.138098 - label: A score: 0.101209 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: AACUCGCUGUGUAAUUCCAGCGAGAGGCAGAGGGAGCGAGCGGGCGGCCGGCUAGGGUGGAAGAGCCGGGCGAGCAGAGCUGCGCUGCGGGCGUCCUGGGAAGGGAGAUCCGGAGCGAAUAGGGGGCUUCGCCUCUGGCCCAGCCCUCCCGCUGAUCCCCCAGCCAGCGGUCCGCAACCCUUGCCGCAUCCACGAAACUUUGCCCAUAGCAGCGGGCGGGCACUUUGCACUGGAACUUACAACACCCGAGCAAGGACGCGACUCUCCCGACGCGGGGAGGCUAUUCUGCCCAUUUGGGGACACUUCCCCGCCGCUGCCAGGACCCGCUUCUCUGAAAGGCUCUCCUUGCAGCUGCUUAGACG - example_title: activating transcription factor 4 mask_index: 20 mask_index_1based: 21 masked_char: A output: - label: U score: 0.209832 - label: C score: 0.178862 - label: X score: 0.15708 - label: G score: 0.136581 - label: A score: 0.118769 pipeline_tag: fill-mask sequence_type: 5' UTR task: fill-mask text: CAUUUCUACUUUGCCCGCCCCAGAUGUAGUUUUCUCUGCGCGUGUGCGUUUUCCCUCCUCCCCGCCCUCAGGGUCCACGGCCACCAUGGCGUAUUAGGGGCAGCAGUGCCUGCGGCAGCAUUGGCCUUUGCAGCGGCGGCAGCAGCACCAGGCUCUGCAGCGGCAACCCCCAGCGGCUUAAGCCAUGGCGCUUCUCACGGCAUUCAGCAGCAGCGUUGCUGUAACCGACAAAGACACCUUCGAAUUAAGCACAUUCCUCGAUUCCAGCAAAGCACCGCAAC - example_title: Human GPI protein p137 mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: A score: 0.291614 - label: X score: 0.155631 - label: U score: 0.129081 - label: G score: 0.125773 - label: C score: 0.123917 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: UUUUUAAAAGGAAAGAUACCAAAUGCCUGCUGCUACCACCCUUUUCAAUUGCUAUGUUUUGAAAGGCACCAGUAUGUGUUUUAGAUUGAUUUAAAUGUUUCAUUUAAAUCACGGACAGUAGUUUCAGUUCUGAUGGUAUAAGCAAAACAAAUAAAACGUUUAUAAAAGUUGUAUCUUGAAACACUGGUGUUCAACAGCUAGCAGCUUAUGUGAUUCACCCCAUGCCACGUUAGUGUCACAAAUUUUAUGGUUUAUCUCCAGCAACAUUUCUCUAGUACUUGCACUUAUUAUCUGAAUUC - example_title: nucleophosmin 1 mask_index: 11 mask_index_1based: 12 masked_char: A output: - label: U score: 0.237947 - label: A score: 0.197577 - label: X score: 0.158222 - label: G score: 0.119338 - label: C score: 0.111704 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: GAAAAUAGUUUAACAAUUUGUUAAAAAAUUUUCCGUCUUAUUUCAUUUCUGUAACAGUUGAUAUCUGGCUGUCCUUUUUAUAAUGCAGAGUGAGAACUUUCCCUACCGUGUUUGAUAAAUGUUGUCCAGGUUCUAUUGCCAAGAAUGUGUUGUCCAAAAUGCCUGUUUAGUUUUUAAAGAUGGAACUCCACCCUUUGCUUGGUUUUAAGUAUGUAUGGAAUGUUAUGAUAGGACAUAGUAGUAGCGGUGGUCAGACAUGGAAAUGGUGGGGAGACAAAAAUAUACAUGUGAAAUAAAACUCAGUAUUUUAAUAAAGUAGCACGGUUUCUAUUGA - example_title: superoxide dismutase 1 mask_index: 12 mask_index_1based: 13 masked_char: A output: - label: C score: 0.226842 - label: A score: 0.170614 - label: X score: 0.15816 - label: U score: 0.149522 - label: G score: 0.108129 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: ACAUUCCCUUGGUGUAGUCUGAGGCCCCUUAACUCAUCUGUUAUCCUGCUAGCUGUAGAAAUGUAUCCUGAUAAACAUUAAACACUGUAAUCUUAAAAGUGUAAUUGUGUGACUUUUUCAGAGUUGCUUUAAAGUACCUGUAGUGAGAAACUGAUUUAUGAUCACUUGGAAGAUUUGUAUAGUUUUAUAAAACUCAGUUAAAAUGUCUGUUUCAAUGACCUGUAUUUUGCCAGACUUAAAUCACAGAUGGGUAUUAAACUUGUCAGAAUUUCUUUGUCAUUCAAGCCUGUGAAUAAAAACCCUGUAUGGCACUUAUUAUGAGGCUAUUAAAAGAAUCCAAAUUCAAACUAAA - example_title: hemoglobin subunit alpha 2 mask_index: 13 mask_index_1based: 14 masked_char: A output: - label: G score: 0.368338 - label: C score: 0.150316 - label: X score: 0.1398 - label: U score: 0.118529 - label: A score: 0.058205 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: CUGGAGCCUCGGUGCCGUUCCUCCUGCCCGCUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGGCCCUUCCUGGUCUUUGAAUAAAGUCUGAGUGGGCAGCA - example_title: BRAF proto-oncogene mask_index: 12 mask_index_1based: 13 masked_char: A output: - label: A score: 0.365678 - label: U score: 0.186248 - label: G score: 0.157475 - label: X score: 0.115548 - label: '*' score: 0.059832 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: AACAAAUGAGUGGAGAGUUCAGGAGAGUAGCAACAAAAGGAAAAUAAAUGAACAUAUGUUUGCUUAUAUGUUAAAUUGAAUAAAAUACUCUCUUUUUUUUUAAGGUGAACCAAAGAACACUUGUGUGGUUAAAGACUAGAUAUAAUUUUUCCCCAAACUAAAAUUUAUACUUAACAUUGGAUUUUUAACAUCCAAGGGUUAAAAUACAUAGACAUUGCUAAAAAUUGGCAGAGCCUCUUCUAGAGGCUUUACUUUCUGUUCCGGGUUUGUAUCAUUCACUUGGUUAUUUUAAGUAGUAAACUUCAGUUUCUCAUGCAACUUUUGUUGCCAGCUAUCACAUGUCCACUAGGGACUCCAGAAGAAGACCCUACCUAUGCCUGUGUUUGCAGGUGAGAAGUUGGCAGUCGGUUAGCCUGGG - example_title: H3 clustered histone 1 mask_index: 17 mask_index_1based: 18 masked_char: A output: - label: G score: 0.24184 - label: A score: 0.191124 - label: X score: 0.162343 - label: C score: 0.129291 - label: U score: 0.11623 pipeline_tag: fill-mask sequence_type: 3' UTR task: fill-mask text: UUACUGUGGUCUCUCUGCGGUCCAAGCAAAGGCUCUUUUCAGAGCCACCACCUUUUC --- # RiNALMo Pre-trained model on non-coding RNA (ncRNA) using a masked language modeling (MLM) objective. ## Disclaimer This is an UNOFFICIAL implementation of the [RiNALMo: General-Purpose RNA Language Models Can Generalize Well on Structure Prediction Tasks](https://doi.org/10.48550/arXiv.2403.00043) by Rafael Josip Penić, et al. The OFFICIAL repository of RiNALMo is at [lbcb-sci/RiNALMo](https://github.com/lbcb-sci/RiNALMo). > [!TIP] > The MultiMolecule team has confirmed that the provided model and checkpoints are producing the same intermediate representations as the original implementation. **The team releasing RiNALMo did not write this model card for this model so this model card has been written by the MultiMolecule team.** ## Model Details RiNALMo is a [bert](https://huggingface.co/google-bert/bert-base-uncased)-style model pre-trained on a large corpus of non-coding RNA sequences in a self-supervised fashion. This means that the model was trained on the raw nucleotides of RNA sequences only, with an automatic process to generate inputs and labels from those texts. Please refer to the [Training Details](#training-details) section for more information on the training process. ### Variants - **[multimolecule/rinalmo-giga](https://huggingface.co/multimolecule/rinalmo-giga)**: The RiNALMo model with 650 million parameters. - **[multimolecule/rinalmo-mega](https://huggingface.co/multimolecule/rinalmo-mega)**: The RiNALMo model with 150 million parameters. - **[multimolecule/rinalmo-micro](https://huggingface.co/multimolecule/rinalmo-micro)**: The RiNALMo model with 30 million parameters. ### Model Specification
Variants Num Layers Hidden Size Num Heads Intermediate Size Num Parameters (M) FLOPs (G) MACs (G) Max Num Tokens
RiNALMo-Giga 33 1280 20 5120 650.88 709.59 354.31 1022
RiNALMo-Mega 30 640 2560 148.04 171.76 85.54
RiNALMo-Micro 12 480 1920 33.48 40.26 20.01
### Links - **Code**: [multimolecule.rinalmo](https://github.com/DLS5-Omics/multimolecule/tree/master/multimolecule/models/rinalmo) - **Data**: [multimolecule/rnacentral](https://huggingface.co/datasets/multimolecule/rnacentral) - **Paper**: [RiNALMo: General-Purpose RNA Language Models Can Generalize Well on Structure Prediction Tasks](https://doi.org/10.48550/arXiv.2403.00043) - **Developed by**: Rafael Josip Penić, Tin Vlašić, Roland G. Huber, Yue Wan, Mile Šikić - **Model type**: [BERT](https://huggingface.co/google-bert/bert-base-uncased) - **Original Repository**: [lbcb-sci/RiNALMo](https://github.com/lbcb-sci/RiNALMo) ## Usage The model file depends on the [`multimolecule`](https://multimolecule.danling.org) library. You can install it using pip: ```bash pip install multimolecule ``` ### Direct Use #### Masked Language Modeling You can use this model directly with a pipeline for masked language modeling: ```python import multimolecule # you must import multimolecule to register models from transformers import pipeline predictor = pipeline("fill-mask", model="multimolecule/rinalmo-giga") output = predictor("gguccucugguuagaccagaucugagccu") ``` ### Downstream Use #### Extract Features Here is how to use this model to get the features of a given sequence in PyTorch: ```python from multimolecule import RnaTokenizer, RiNALMoModel tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo-giga") model = RiNALMoModel.from_pretrained("multimolecule/rinalmo-giga") text = "UAGCUUAUCAGACUGAUGUUG" input = tokenizer(text, return_tensors="pt") output = model(**input) ``` #### Sequence Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for sequence classification or regression. Here is how to use this model as backbone to fine-tune for a sequence-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RiNALMoForSequencePrediction tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo-giga") model = RiNALMoForSequencePrediction.from_pretrained("multimolecule/rinalmo-giga") text = "UAGCUUAUCAGACUGAUGUUG" input = tokenizer(text, return_tensors="pt") label = torch.tensor([1]) output = model(**input, labels=label) ``` #### Token Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for token classification or regression. Here is how to use this model as backbone to fine-tune for a nucleotide-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RiNALMoForTokenPrediction tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo-giga") model = RiNALMoForTokenPrediction.from_pretrained("multimolecule/rinalmo-giga") text = "UAGCUUAUCAGACUGAUGUUG" input = tokenizer(text, return_tensors="pt") label = torch.randint(2, (len(text), )) output = model(**input, labels=label) ``` #### Contact Classification / Regression > [!NOTE] > This model is not fine-tuned for any specific task. You will need to fine-tune the model on a downstream task to use it for contact classification or regression. Here is how to use this model as backbone to fine-tune for a contact-level task in PyTorch: ```python import torch from multimolecule import RnaTokenizer, RiNALMoForContactPrediction tokenizer = RnaTokenizer.from_pretrained("multimolecule/rinalmo-giga") model = RiNALMoForContactPrediction.from_pretrained("multimolecule/rinalmo-giga") text = "UAGCUUAUCAGACUGAUGUUG" input = tokenizer(text, return_tensors="pt") label = torch.randint(2, (len(text), len(text))) output = model(**input, labels=label) ``` ## Training Details RiNALMo used Masked Language Modeling (MLM) as the pre-training objective: taking a sequence, the model randomly masks 15% of the tokens in the input then runs the entire masked sentence through the model and has to predict the masked tokens. This is comparable to the Cloze task in language modeling. ### Training Data The RiNALMo model was pre-trained on a cocktail of databases including [RNAcentral](https://rnacentral.org), [Rfam](https://rfam.org), [Ensembl Genome Browser](https://ensembl.org), and [Nucleotide](https://ncbi.nlm.nih.gov/nucleotide). The training data contains 36 million unique ncRNA sequences. To ensure sequence diversity in each training batch, RiNALMo clustered the sequences with [MMSeqs2](https://github.com/soedinglab/MMseqs2) into 17 million clusters and then sampled each sequence in the batch from a different cluster. RiNALMo preprocessed all tokens by replacing "U"s with "T"s. Note that during model conversions, "T" is replaced with "U". [`RnaTokenizer`][multimolecule.RnaTokenizer] will convert "T"s to "U"s for you, you may disable this behaviour by passing `replace_T_with_U=False`. ### Training Procedure #### Preprocessing RiNALMo used masked language modeling (MLM) as the pre-training objective. The masking procedure is similar to the one used in BERT: - Mask rate: 15% - Replacement: `` for 80% of masked tokens - Replacement: random token for 10% of masked tokens - Replacement: unchanged token for 10% of masked tokens #### Pre-training The model was trained on 7 NVIDIA A100 GPUs with 80GiB memories. - Batch Size: 1344 - Epochs: 6 - Learning rate: 5e-5 - Learning rate scheduler: Cosine - Learning rate warm-up: 2,000 steps - Learning rate minimum: 1e-5 - Dropout: 0.1 ## Citation ```bibtex @ARTICLE{Penic2025-qf, title = "{RiNALMo}: general-purpose {RNA} language models can generalize well on structure prediction tasks", author = "Peni{\'c}, Rafael Josip and Vla{\v s}i{\'c}, Tin and Huber, Roland G and Wan, Yue and {\v S}iki{\'c}, Mile", abstract = "While RNA has recently been recognized as an interesting small-molecule drug target, many challenges remain to be addressed before we take full advantage of it. This emphasizes the necessity to improve our understanding of its structures and functions. Over the years, sequencing technologies have produced an enormous amount of unlabeled RNA data, which hides a huge potential. Motivated by the successes of protein language models, we introduce RiboNucleic Acid Language Model (RiNALMo) to unveil the hidden code of RNA. RiNALMo is the largest RNA language model to date, with 650M parameters pre-trained on 36M non-coding RNA sequences from several databases. It can extract hidden knowledge and capture the underlying structure information implicitly embedded within the RNA sequences. RiNALMo achieves state-of-the-art results on several downstream tasks. Notably, we show that its generalization capabilities overcome the inability of other deep learning methods for secondary structure prediction to generalize on unseen RNA families.", journal = "Nature Communications", publisher = "Springer Science and Business Media LLC", volume = 16, number = 1, pages = "5671", month = jul, year = 2025, copyright = "https://creativecommons.org/licenses/by-nc-nd/4.0", language = "en" } ``` > [!NOTE] > The artifacts distributed in this repository are part of the MultiMolecule project. > If MultiMolecule supports your research, please cite the MultiMolecule project as follows: ```bibtex @software{chen_2024_12638419, author = {Chen, Zhiyuan and Zhu, Sophia Y.}, title = {MultiMolecule}, doi = {10.5281/zenodo.12638419}, publisher = {Zenodo}, url = {https://doi.org/10.5281/zenodo.12638419}, year = 2024, month = may, day = 4 } ``` ## Contact Please use GitHub issues of [MultiMolecule](https://github.com/DLS5-Omics/multimolecule/issues) for any questions or comments on the model card. Please contact the authors of the [RiNALMo paper](https://doi.org/10.48550/arXiv.2403.00043) for questions or comments on the paper/model. ## License This model implementation is licensed under the [GNU Affero General Public License](license.md). For additional terms and clarifications, please refer to our [License FAQ](license-faq.md). ```spdx SPDX-License-Identifier: AGPL-3.0-or-later ```